\
| Variant ID: vg0819075122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19075122 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTATCACTTTTTCTATTGTAAATTTGGTACCTAGGTACTATGAGGTATCATGAGGTAACAAAAAAAATAATGTAAAATTTGGTACCTCATTGTACCTCCT[T/C]
AAGGACCGTAAAATTGCTCTAAAGTTTATGGTTTGAAACTAAAATAGTCAAAATAATTATGAAATAGGGAAGCTGGATTATCAAAATTCCTTTCTACCGT
ACGGTAGAAAGGAATTTTGATAATCCAGCTTCCCTATTTCATAATTATTTTGACTATTTTAGTTTCAAACCATAAACTTTAGAGCAATTTTACGGTCCTT[A/G]
AGGAGGTACAATGAGGTACCAAATTTTACATTATTTTTTTTGTTACCTCATGATACCTCATAGTACCTAGGTACCAAATTTACAATAGAAAAAGTGATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 13.20% | 1.42% | 0.28% | NA |
| All Indica | 2759 | 98.30% | 1.10% | 0.14% | 0.47% | NA |
| All Japonica | 1512 | 61.40% | 34.50% | 4.10% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 0.70% | 0.00% | 1.42% | NA |
| Indica Intermediate | 786 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 36.20% | 58.80% | 4.95% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 3.60% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 22.00% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 35.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819075122 | T -> C | LOC_Os08g30900.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.482; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0819075122 | T -> C | LOC_Os08g30900.2 | intron_variant ; MODIFIER | silent_mutation | Average:43.482; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0819075122 | T -> DEL | N | N | silent_mutation | Average:43.482; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819075122 | 7.90E-06 | NA | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | NA | 1.20E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | 3.00E-07 | NA | mr1261_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | NA | 5.08E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | NA | 4.06E-07 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | NA | 1.65E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | NA | 5.91E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | 8.72E-07 | 4.76E-18 | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819075122 | NA | 8.38E-08 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |