\
| Variant ID: vg0819074999 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19074999 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAAGTTCAAGTTCCACCAAATGCCAATACATGTTAGGTGTATATATCAATACGAGAATCAAATTTAGATTTTACACAGAGCTATGCCAAATCAAATTAT[G/T]
GTCCTTGAGAAGGTACCATGAGGTATCACTTTTTCTATTGTAAATTTGGTACCTAGGTACTATGAGGTATCATGAGGTAACAAAAAAAATAATGTAAAAT
ATTTTACATTATTTTTTTTGTTACCTCATGATACCTCATAGTACCTAGGTACCAAATTTACAATAGAAAAAGTGATACCTCATGGTACCTTCTCAAGGAC[C/A]
ATAATTTGATTTGGCATAGCTCTGTGTAAAATCTAAATTTGATTCTCGTATTGATATATACACCTAACATGTATTGGCATTTGGTGGAACTTGAACTTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.70% | 0.00% | 0.25% | NA |
| All Indica | 2759 | 97.30% | 2.30% | 0.00% | 0.43% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.40% | 57.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 1.50% | 0.00% | 1.31% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819074999 | G -> T | LOC_Os08g30900.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.449; most accessible tissue: Callus, score: 80.368 | N | N | N | N |
| vg0819074999 | G -> T | LOC_Os08g30900.2 | intron_variant ; MODIFIER | silent_mutation | Average:44.449; most accessible tissue: Callus, score: 80.368 | N | N | N | N |
| vg0819074999 | G -> DEL | N | N | silent_mutation | Average:44.449; most accessible tissue: Callus, score: 80.368 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819074999 | 3.16E-06 | 2.65E-28 | mr1099 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 1.93E-16 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 4.44E-06 | 6.49E-20 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 3.74E-07 | 8.44E-23 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 6.40E-06 | 1.69E-18 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 2.20E-06 | 1.52E-23 | mr1120 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 2.93E-08 | 1.50E-28 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 1.44E-17 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 2.77E-06 | 3.47E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 1.96E-22 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | 2.26E-07 | 1.56E-17 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 4.14E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 3.80E-18 | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 2.76E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 3.67E-18 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 2.14E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 5.63E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 2.53E-23 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819074999 | NA | 5.32E-16 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |