Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819026111:

Variant ID: vg0819026111 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19026111
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTCGTATTCGTATCTGTATCCGAACTATCCAAGAATTATCCGATCCGAAAGGTATCCGTATTCGTTTTTCTCCGGAGCGGACGGGAACTATCTGCTCT[G/A]
TTTTCATCCCTAATACTGACTAGTCATACAATACAACCAATTTTTGATATTTTTATAAATCTTTGCTTAATTTATTCAGGTGTTGATGCTTAGAAATTAG

Reverse complement sequence

CTAATTTCTAAGCATCAACACCTGAATAAATTAAGCAAAGATTTATAAAAATATCAAAAATTGGTTGTATTGTATGACTAGTCAGTATTAGGGATGAAAA[C/T]
AGAGCAGATAGTTCCCGTCCGCTCCGGAGAAAAACGAATACGGATACCTTTCGGATCGGATAATTCTTGGATAGTTCGGATACAGATACGAATACGAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.90%	16.30%	4.76%	0.00%	NA
All Indica	2759	65.20%	26.80%	7.94%	0.00%	NA
All Japonica	1512	99.10%	0.70%	0.20%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	61.70%	17.60%	20.67%	0.00%	NA
Indica II	465	20.00%	69.20%	10.75%	0.00%	NA
Indica III	913	89.60%	10.00%	0.44%	0.00%	NA
Indica Intermediate	786	66.40%	28.20%	5.34%	0.00%	NA
Temperate Japonica	767	99.10%	0.50%	0.39%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	20.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819026111	G -> A	LOC_Os08g30810.1	intron_variant ; MODIFIER	silent_mutation	Average:39.311; most accessible tissue: Callus, score: 55.715	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819026111	NA	8.86E-06	mr1137_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	1.18E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	1.94E-09	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	5.75E-11	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	9.33E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	1.33E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	2.98E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	9.30E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	9.63E-08	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	6.43E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	6.83E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	1.74E-06	NA	mr1559_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	2.11E-11	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	1.02E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	9.72E-06	mr1813_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819026111	NA	8.15E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251