\
| Variant ID: vg0818939785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18939785 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAATAATCCAAATAAAAAAGTCAAGTGTGTCATGCATTAGAAAAATAGAGACAATAGTTCCACTGCTAGATAGAAGGTGGTATGGCATATATAGTTTTGA[G/C]
CTTTTGACTGTACACCAATAAAACAACACGGATTCATGTGCCGGTTGCTCGTTACAATTTTGTCATGAATGCTCACTTTATGAATGAACAATGCAGCTGA
TCAGCTGCATTGTTCATTCATAAAGTGAGCATTCATGACAAAATTGTAACGAGCAACCGGCACATGAATCCGTGTTGTTTTATTGGTGTACAGTCAAAAG[C/G]
TCAAAACTATATATGCCATACCACCTTCTATCTAGCAGTGGAACTATTGTCTCTATTTTTCTAATGCATGACACACTTGACTTTTTTATTTGGATTATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 0.70% | 1.16% | 18.37% | NA |
| All Indica | 2759 | 74.20% | 0.00% | 0.83% | 24.94% | NA |
| All Japonica | 1512 | 84.80% | 2.10% | 1.85% | 11.31% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 94.50% | 0.00% | 0.17% | 5.38% | NA |
| Indica II | 465 | 92.00% | 0.00% | 0.43% | 7.53% | NA |
| Indica III | 913 | 54.70% | 0.00% | 1.53% | 43.81% | NA |
| Indica Intermediate | 786 | 71.10% | 0.00% | 0.76% | 28.12% | NA |
| Temperate Japonica | 767 | 92.80% | 3.90% | 3.26% | 0.00% | NA |
| Tropical Japonica | 504 | 68.50% | 0.00% | 0.60% | 30.95% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.40% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818939785 | G -> C | LOC_Os08g30710.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.025; most accessible tissue: Callus, score: 62.286 | N | N | N | N |
| vg0818939785 | G -> DEL | N | N | silent_mutation | Average:30.025; most accessible tissue: Callus, score: 62.286 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818939785 | 3.25E-06 | 3.25E-06 | mr1081_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818939785 | NA | 1.10E-06 | mr1298_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818939785 | NA | 5.35E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818939785 | NA | 9.51E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818939785 | NA | 1.03E-07 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818939785 | NA | 2.37E-06 | mr1731_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |