\
| Variant ID: vg0818851085 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18851085 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, C: 0.44, others allele: 0.00, population size: 80. )
AAGGACACAAAGTCTCCAAGAAACAACACTCAAGAAATAACCTTAATAACACTTTTCTACTATACTTTCTCCGCCCATTTTTAAGTGCAGTTGTGGTTTT[T/C]
TTTTTCCAATGTTTAACCATCCATCTTATTTGATATTTTTTATGATTAGTATTTTTATTGCTATTAGATAATAAAGCATCACTAGTACTTTAAGCGTGTC
GACACGCTTAAAGTACTAGTGATGCTTTATTATCTAATAGCAATAAAAATACTAATCATAAAAAATATCAAATAAGATGGATGGTTAAACATTGGAAAAA[A/G]
AAAACCACAACTGCACTTAAAAATGGGCGGAGAAAGTATAGTAGAAAAGTGTTATTAAGGTTATTTCTTGAGTGTTGTTTCTTGGAGACTTTGTGTCCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.10% | 25.30% | 9.25% | 22.39% | NA |
| All Indica | 2759 | 65.90% | 3.60% | 4.39% | 26.06% | NA |
| All Japonica | 1512 | 1.40% | 58.40% | 19.44% | 20.77% | NA |
| Aus | 269 | 58.70% | 36.40% | 2.23% | 2.60% | NA |
| Indica I | 595 | 78.20% | 4.70% | 8.57% | 8.57% | NA |
| Indica II | 465 | 87.30% | 1.70% | 2.37% | 8.60% | NA |
| Indica III | 913 | 50.50% | 3.80% | 3.40% | 42.28% | NA |
| Indica Intermediate | 786 | 62.00% | 3.70% | 3.56% | 30.79% | NA |
| Temperate Japonica | 767 | 0.50% | 75.10% | 19.82% | 4.56% | NA |
| Tropical Japonica | 504 | 2.60% | 26.20% | 22.62% | 48.61% | NA |
| Japonica Intermediate | 241 | 1.70% | 72.60% | 11.62% | 14.11% | NA |
| VI/Aromatic | 96 | 9.40% | 78.10% | 8.33% | 4.17% | NA |
| Intermediate | 90 | 32.20% | 43.30% | 8.89% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818851085 | T -> C | LOC_Os08g30590.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.255; most accessible tissue: Callus, score: 37.245 | N | N | N | N |
| vg0818851085 | T -> DEL | N | N | silent_mutation | Average:24.255; most accessible tissue: Callus, score: 37.245 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818851085 | NA | 7.71E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 1.32E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | 8.41E-09 | 8.41E-09 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 1.16E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 1.10E-06 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 2.19E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 7.75E-06 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 3.99E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 4.75E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 5.45E-10 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | 4.77E-06 | 4.77E-06 | mr1873 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | 2.85E-06 | 2.85E-06 | mr1893 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 1.56E-10 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 2.73E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 9.90E-12 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818851085 | NA | 5.38E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |