\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818851085:

Variant ID: vg0818851085 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18851085
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, C: 0.44, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGACACAAAGTCTCCAAGAAACAACACTCAAGAAATAACCTTAATAACACTTTTCTACTATACTTTCTCCGCCCATTTTTAAGTGCAGTTGTGGTTTT[T/C]
TTTTTCCAATGTTTAACCATCCATCTTATTTGATATTTTTTATGATTAGTATTTTTATTGCTATTAGATAATAAAGCATCACTAGTACTTTAAGCGTGTC

Reverse complement sequence

GACACGCTTAAAGTACTAGTGATGCTTTATTATCTAATAGCAATAAAAATACTAATCATAAAAAATATCAAATAAGATGGATGGTTAAACATTGGAAAAA[A/G]
AAAACCACAACTGCACTTAAAAATGGGCGGAGAAAGTATAGTAGAAAAGTGTTATTAAGGTTATTTCTTGAGTGTTGTTTCTTGGAGACTTTGTGTCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 25.30% 9.25% 22.39% NA
All Indica  2759 65.90% 3.60% 4.39% 26.06% NA
All Japonica  1512 1.40% 58.40% 19.44% 20.77% NA
Aus  269 58.70% 36.40% 2.23% 2.60% NA
Indica I  595 78.20% 4.70% 8.57% 8.57% NA
Indica II  465 87.30% 1.70% 2.37% 8.60% NA
Indica III  913 50.50% 3.80% 3.40% 42.28% NA
Indica Intermediate  786 62.00% 3.70% 3.56% 30.79% NA
Temperate Japonica  767 0.50% 75.10% 19.82% 4.56% NA
Tropical Japonica  504 2.60% 26.20% 22.62% 48.61% NA
Japonica Intermediate  241 1.70% 72.60% 11.62% 14.11% NA
VI/Aromatic  96 9.40% 78.10% 8.33% 4.17% NA
Intermediate  90 32.20% 43.30% 8.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818851085 T -> C LOC_Os08g30590.1 intron_variant ; MODIFIER silent_mutation Average:24.255; most accessible tissue: Callus, score: 37.245 N N N N
vg0818851085 T -> DEL N N silent_mutation Average:24.255; most accessible tissue: Callus, score: 37.245 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818851085 NA 7.71E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 1.32E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 8.41E-09 8.41E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 1.16E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 1.10E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 2.19E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 7.75E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 3.99E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 4.75E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 5.45E-10 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 4.77E-06 4.77E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 2.85E-06 2.85E-06 mr1893 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 1.56E-10 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 2.73E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 9.90E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818851085 NA 5.38E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251