\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818818092:

Variant ID: vg0818818092 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18818092
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATGGATAAGATTGAAGGAGGGTATTTTGGTTAGTTTGAATAATAAATAGATTTATTTTCTTTTTCCTAAATGAAACCCTATCAGTATATTGCAAATA[T/G]
AGTCAAACGGTAGGTTCAATTGTGAAAAGCAGGGTTAAATCAGCAACCTAGAAAAAAATAAGATCCGATTGGTAGTTAGCCTTCGAAATAGGGTCAAATA

Reverse complement sequence

TATTTGACCCTATTTCGAAGGCTAACTACCAATCGGATCTTATTTTTTTCTAGGTTGCTGATTTAACCCTGCTTTTCACAATTGAACCTACCGTTTGACT[A/C]
TATTTGCAATATACTGATAGGGTTTCATTTAGGAAAAAGAAAATAAATCTATTTATTATTCAAACTAACCAAAATACCCTCCTTCAATCTTATCCATCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 13.10% 0.17% 2.69% NA
All Indica  2759 79.20% 15.90% 0.29% 4.60% NA
All Japonica  1512 88.60% 11.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 4.70% 0.00% 0.17% NA
Indica II  465 92.70% 6.50% 0.00% 0.86% NA
Indica III  913 68.70% 20.60% 0.33% 10.41% NA
Indica Intermediate  786 71.20% 24.70% 0.64% 3.44% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 31.50% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818818092 T -> G LOC_Os08g30554.1 upstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg0818818092 T -> G LOC_Os08g30550.1 downstream_gene_variant ; 3477.0bp to feature; MODIFIER silent_mutation Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg0818818092 T -> G LOC_Os08g30550-LOC_Os08g30554 intergenic_region ; MODIFIER silent_mutation Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N
vg0818818092 T -> DEL N N silent_mutation Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818818092 NA 5.31E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 1.22E-09 1.22E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 9.33E-06 9.32E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 6.82E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 8.43E-06 1.23E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 3.10E-06 mr1352 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 2.61E-07 2.24E-06 mr1358 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 9.43E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 2.86E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 4.73E-06 4.73E-06 mr1756 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 1.80E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 2.96E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 5.49E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 1.81E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818818092 NA 2.18E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251