\
| Variant ID: vg0818818092 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18818092 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 218. )
GAGATGGATAAGATTGAAGGAGGGTATTTTGGTTAGTTTGAATAATAAATAGATTTATTTTCTTTTTCCTAAATGAAACCCTATCAGTATATTGCAAATA[T/G]
AGTCAAACGGTAGGTTCAATTGTGAAAAGCAGGGTTAAATCAGCAACCTAGAAAAAAATAAGATCCGATTGGTAGTTAGCCTTCGAAATAGGGTCAAATA
TATTTGACCCTATTTCGAAGGCTAACTACCAATCGGATCTTATTTTTTTCTAGGTTGCTGATTTAACCCTGCTTTTCACAATTGAACCTACCGTTTGACT[A/C]
TATTTGCAATATACTGATAGGGTTTCATTTAGGAAAAAGAAAATAAATCTATTTATTATTCAAACTAACCAAAATACCCTCCTTCAATCTTATCCATCTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 13.10% | 0.17% | 2.69% | NA |
| All Indica | 2759 | 79.20% | 15.90% | 0.29% | 4.60% | NA |
| All Japonica | 1512 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 4.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 92.70% | 6.50% | 0.00% | 0.86% | NA |
| Indica III | 913 | 68.70% | 20.60% | 0.33% | 10.41% | NA |
| Indica Intermediate | 786 | 71.20% | 24.70% | 0.64% | 3.44% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818818092 | T -> G | LOC_Os08g30554.1 | upstream_gene_variant ; 3173.0bp to feature; MODIFIER | silent_mutation | Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| vg0818818092 | T -> G | LOC_Os08g30550.1 | downstream_gene_variant ; 3477.0bp to feature; MODIFIER | silent_mutation | Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| vg0818818092 | T -> G | LOC_Os08g30550-LOC_Os08g30554 | intergenic_region ; MODIFIER | silent_mutation | Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| vg0818818092 | T -> DEL | N | N | silent_mutation | Average:46.509; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818818092 | NA | 5.31E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | 1.22E-09 | 1.22E-09 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | 9.33E-06 | 9.32E-06 | mr1299 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 6.82E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | 8.43E-06 | 1.23E-07 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 3.10E-06 | mr1352 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | 2.61E-07 | 2.24E-06 | mr1358 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 9.43E-06 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 2.86E-07 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | 4.73E-06 | 4.73E-06 | mr1756 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 1.80E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 2.96E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 5.49E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 1.81E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818818092 | NA | 2.18E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |