\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818778107:

Variant ID: vg0818778107 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18778107
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, G: 0.42, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGACGGCGACGGAGTACAGTGAATCGGGCGTCCGGTTCAGGGTCAGGTCAGATTCAGAGCCTGCCCCTCGTTTCGGGCTCCTCGACGTGGACTTCTCG[T/G]
GGGGCGTGGTGACCATGTCGCGCCACGTGATCGACGAGAAGATGAGCTGCGTGTTCCGCAACGTGCTGGCGTTCGAGCAGGACAGCGGCGCCGGCGTGGA

Reverse complement sequence

TCCACGCCGGCGCCGCTGTCCTGCTCGAACGCCAGCACGTTGCGGAACACGCAGCTCATCTTCTCGTCGATCACGTGGCGCGACATGGTCACCACGCCCC[A/C]
CGAGAAGTCCACGTCGAGGAGCCCGAAACGAGGGGCAGGCTCTGAATCTGACCTGACCCTGAACCGGACGCCCGATTCACTGTACTCCGTCGCCGTCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 35.80% 0.68% 15.26% NA
All Indica  2759 71.80% 7.20% 1.12% 19.86% NA
All Japonica  1512 1.90% 87.00% 0.00% 11.11% NA
Aus  269 86.20% 13.40% 0.37% 0.00% NA
Indica I  595 78.20% 17.10% 0.34% 4.37% NA
Indica II  465 86.20% 4.50% 2.58% 6.67% NA
Indica III  913 67.30% 1.60% 0.55% 30.56% NA
Indica Intermediate  786 63.60% 7.90% 1.53% 26.97% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 66.10% 0.00% 30.36% NA
Japonica Intermediate  241 2.10% 91.70% 0.00% 6.22% NA
VI/Aromatic  96 9.40% 89.60% 0.00% 1.04% NA
Intermediate  90 35.60% 60.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818778107 T -> G LOC_Os08g30520.1 missense_variant ; p.Trp342Gly; MODERATE nonsynonymous_codon ; W342G Average:90.913; most accessible tissue: Zhenshan97 flower, score: 97.776 unknown unknown TOLERATED 0.56
vg0818778107 T -> DEL LOC_Os08g30520.1 N frameshift_variant Average:90.913; most accessible tissue: Zhenshan97 flower, score: 97.776 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818778107 T G -0.04 -0.07 -0.03 -0.05 -0.06 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818778107 NA 4.02E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818778107 5.35E-06 5.35E-06 mr1362 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818778107 NA 4.06E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818778107 1.56E-06 4.01E-10 mr1852 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818778107 NA 1.17E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251