\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818727476:

Variant ID: vg0818727476 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18727476
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTATTGCACAACTATATCCTGTTCACTATAATATTTGTTATTAAATTGATATGGTTTACTAAATAAAAGAGAGATCAATTGTCAATCATTTCTACTA[C/G,T]
TAGTAAACACCACCATAAAAGTATAGTAGGCAGGAAGTAAAAGCAGCTATTGTATTTTACTGACAATTCTTAATGCATCTATGTAGTTCTCCTGTATATC

Reverse complement sequence

GATATACAGGAGAACTACATAGATGCATTAAGAATTGTCAGTAAAATACAATAGCTGCTTTTACTTCCTGCCTACTATACTTTTATGGTGGTGTTTACTA[G/C,A]
TAGTAGAAATGATTGACAATTGATCTCTCTTTTATTTAGTAAACCATATCAATTTAATAACAAATATTATAGTGAACAGGATATAGTTGTGCAATAAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 15.80% 0.04% 0.00% T: 0.06%
All Indica  2759 79.20% 20.70% 0.07% 0.00% T: 0.04%
All Japonica  1512 88.60% 11.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 92.70% 7.30% 0.00% 0.00% NA
Indica III  913 68.10% 31.80% 0.11% 0.00% NA
Indica Intermediate  786 72.30% 27.50% 0.13% 0.00% T: 0.13%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 68.70% 31.30% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818727476 C -> G LOC_Os08g30430.1 upstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:43.916; most accessible tissue: Callus, score: 64.749 N N N N
vg0818727476 C -> G LOC_Os08g30420-LOC_Os08g30430 intergenic_region ; MODIFIER silent_mutation Average:43.916; most accessible tissue: Callus, score: 64.749 N N N N
vg0818727476 C -> T LOC_Os08g30430.1 upstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:43.916; most accessible tissue: Callus, score: 64.749 N N N N
vg0818727476 C -> T LOC_Os08g30420-LOC_Os08g30430 intergenic_region ; MODIFIER silent_mutation Average:43.916; most accessible tissue: Callus, score: 64.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818727476 NA 4.85E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 NA 9.37E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 2.58E-06 1.30E-06 mr1266 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 1.15E-09 1.14E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 NA 3.84E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 NA 5.61E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 NA 3.66E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 NA 2.12E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818727476 NA 5.69E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251