\
| Variant ID: vg0818727476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18727476 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 232. )
GCTTTATTGCACAACTATATCCTGTTCACTATAATATTTGTTATTAAATTGATATGGTTTACTAAATAAAAGAGAGATCAATTGTCAATCATTTCTACTA[C/G,T]
TAGTAAACACCACCATAAAAGTATAGTAGGCAGGAAGTAAAAGCAGCTATTGTATTTTACTGACAATTCTTAATGCATCTATGTAGTTCTCCTGTATATC
GATATACAGGAGAACTACATAGATGCATTAAGAATTGTCAGTAAAATACAATAGCTGCTTTTACTTCCTGCCTACTATACTTTTATGGTGGTGTTTACTA[G/C,A]
TAGTAGAAATGATTGACAATTGATCTCTCTTTTATTTAGTAAACCATATCAATTTAATAACAAATATTATAGTGAACAGGATATAGTTGTGCAATAAAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.10% | 15.80% | 0.04% | 0.00% | T: 0.06% |
| All Indica | 2759 | 79.20% | 20.70% | 0.07% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.10% | 31.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 72.30% | 27.50% | 0.13% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.70% | 31.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 0.00% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818727476 | C -> G | LOC_Os08g30430.1 | upstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:43.916; most accessible tissue: Callus, score: 64.749 | N | N | N | N |
| vg0818727476 | C -> G | LOC_Os08g30420-LOC_Os08g30430 | intergenic_region ; MODIFIER | silent_mutation | Average:43.916; most accessible tissue: Callus, score: 64.749 | N | N | N | N |
| vg0818727476 | C -> T | LOC_Os08g30430.1 | upstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:43.916; most accessible tissue: Callus, score: 64.749 | N | N | N | N |
| vg0818727476 | C -> T | LOC_Os08g30420-LOC_Os08g30430 | intergenic_region ; MODIFIER | silent_mutation | Average:43.916; most accessible tissue: Callus, score: 64.749 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818727476 | NA | 4.85E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | NA | 9.37E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | 2.58E-06 | 1.30E-06 | mr1266 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | 1.15E-09 | 1.14E-09 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | NA | 3.84E-07 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | NA | 5.61E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | NA | 3.66E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | NA | 2.12E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818727476 | NA | 5.69E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |