\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818684623:

Variant ID: vg0818684623 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18684623
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGTTGAACAGGCGTCGAATCTCGCAAGAGGCAAAGAAGCAACGACTAGCCAACCTGGGCACGACCACACTGTACCATATCTGTGACTTTGGATCCTT[T/A]
ATATCAGACAAATTTGTAACTAAAGATGCATGGCCTGCATGCATGATCCACATGTCCAATTTACTAAAAACTAAGTAGTTAATTTTGAAAAATTTCATAT

Reverse complement sequence

ATATGAAATTTTTCAAAATTAACTACTTAGTTTTTAGTAAATTGGACATGTGGATCATGCATGCAGGCCATGCATCTTTAGTTACAAATTTGTCTGATAT[A/T]
AAGGATCCAAAGTCACAGATATGGTACAGTGTGGTCGTGCCCAGGTTGGCTAGTCGTTGCTTCTTTGCCTCTTGCGAGATTCGACGCCTGTTCAACTTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.60% 0.08% 0.00% NA
All Indica  2759 79.40% 20.50% 0.07% 0.00% NA
All Japonica  1512 88.80% 11.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 4.40% 0.17% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 68.00% 32.00% 0.00% 0.00% NA
Indica Intermediate  786 72.60% 27.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 69.20% 30.40% 0.40% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818684623 T -> A LOC_Os08g30360.1 downstream_gene_variant ; 1965.0bp to feature; MODIFIER silent_mutation Average:67.365; most accessible tissue: Callus, score: 96.079 N N N N
vg0818684623 T -> A LOC_Os08g30370.1 downstream_gene_variant ; 1279.0bp to feature; MODIFIER silent_mutation Average:67.365; most accessible tissue: Callus, score: 96.079 N N N N
vg0818684623 T -> A LOC_Os08g30360-LOC_Os08g30370 intergenic_region ; MODIFIER silent_mutation Average:67.365; most accessible tissue: Callus, score: 96.079 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818684623 T A -0.04 -0.05 -0.03 -0.04 -0.12 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818684623 NA 3.73E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 8.10E-06 6.78E-08 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 2.61E-12 2.61E-12 mr1266 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 NA 2.51E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 2.22E-06 2.22E-06 mr1537 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 NA 4.41E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 NA 4.88E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 NA 4.26E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684623 NA 9.75E-07 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251