\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818684028:

Variant ID: vg0818684028 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 18684028
Reference Allele: ACATCCAAACGGATGTACACAGCCAAAGTTGTGAlternative Allele: GCATCCAAACGGATGTACACAGCCAAAGTTGTG,A
Primary Allele: ACATCCAAACGGATGTACAC AGCCAAAGTTGTGSecondary Allele: GCATCCAAACGGATGTACAC AGCCAAAGTTGTG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGTTGGGACGTGTAAAACAAATATCATCGTCTTGATGAAGTTATGGAGTTATAGTTGTGGGACTCGTTTTTTTTACATAATGGATTAAACCGGCCTCT[ACATCCAAACGGATGTACACAGCCAAAGTTGTG/GCATCCAAACGGATGTACACAGCCAAAGTTGTG,A]
GGACTCATTTTAGTCGAGATAAATTCAAATGACACCTAAAATTAAAGATGGCCTTGTGAATTCTTACTCTGGAATACTCGGTGCAGAGACTGAGAATTAT

Reverse complement sequence

ATAATTCTCAGTCTCTGCACCGAGTATTCCAGAGTAAGAATTCACAAGGCCATCTTTAATTTTAGGTGTCATTTGAATTTATCTCGACTAAAATGAGTCC[CACAACTTTGGCTGTGTACATCCGTTTGGATGT/CACAACTTTGGCTGTGTACATCCGTTTGGATGC,T]
AGAGGCCGGTTTAATCCATTATGTAAAAAAAACGAGTCCCACAACTATAACTCCATAACTTCATCAAGACGATGATATTTGTTTTACACGTCCCAACTCT

Allele Frequencies:

Populations Population SizeFrequency of ACATCCAAACGGATGTACAC AGCCAAAGTTGTG(primary allele) Frequency of GCATCCAAACGGATGTACAC AGCCAAAGTTGTG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 11.20% 1.25% 14.71% A: 4.34%
All Indica  2759 53.80% 18.40% 2.10% 18.81% A: 6.92%
All Japonica  1512 87.50% 0.70% 0.07% 11.31% A: 0.46%
Aus  269 99.30% 0.00% 0.00% 0.00% A: 0.74%
Indica I  595 86.20% 6.70% 1.01% 4.54% A: 1.51%
Indica II  465 19.40% 70.30% 3.01% 6.02% A: 1.29%
Indica III  913 54.00% 0.20% 2.41% 28.59% A: 14.79%
Indica Intermediate  786 49.40% 17.60% 2.04% 25.83% A: 5.22%
Temperate Japonica  767 98.80% 0.30% 0.00% 0.00% A: 0.91%
Tropical Japonica  504 67.70% 1.20% 0.20% 30.95% NA
Japonica Intermediate  241 92.90% 0.80% 0.00% 6.22% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 1.04% A: 1.04%
Intermediate  90 80.00% 11.10% 0.00% 4.44% A: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> GCATCCAAACGGATGTACACAGCCAAAGTT GTG LOC_Os08g30360.1 downstream_gene_variant ; 1370.0bp to feature; MODIFIER silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> GCATCCAAACGGATGTACACAGCCAAAGTT GTG LOC_Os08g30370.1 downstream_gene_variant ; 1874.0bp to feature; MODIFIER silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> GCATCCAAACGGATGTACACAGCCAAAGTT GTG LOC_Os08g30360-LOC_Os08g30370 intergenic_region ; MODIFIER silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> A LOC_Os08g30360.1 downstream_gene_variant ; 1371.0bp to feature; MODIFIER silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> A LOC_Os08g30370.1 downstream_gene_variant ; 1873.0bp to feature; MODIFIER silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> A LOC_Os08g30360-LOC_Os08g30370 intergenic_region ; MODIFIER silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N
vg0818684028 ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> DEL N N silent_mutation Average:49.109; most accessible tissue: Callus, score: 88.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818684028 NA 1.91E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818684028 NA 2.91E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 4.10E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.08E-11 mr1180 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 7.59E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.88E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.61E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.95E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.57E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.84E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.16E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.58E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 3.48E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.30E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.57E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.72E-12 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.22E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.61E-14 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 8.21E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.71E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 9.69E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.55E-07 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.33E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.54E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.69E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.64E-09 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.25E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.56E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 2.37E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 9.24E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 1.13E-12 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 6.68E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 7.87E-11 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.36E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.23E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 3.74E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 3.57E-06 mr1893_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.63E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 3.11E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 5.63E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028 NA 7.56E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251