Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818684028:

Variant ID: vg0818684028 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 18684028
Reference Allele: ACATCCAAACGGATGTACACAGCCAAAGTTGTG	Alternative Allele: GCATCCAAACGGATGTACACAGCCAAAGTTGTG,A
Primary Allele: ACATCCAAACGGATGTACAC AGCCAAAGTTGTG	Secondary Allele: GCATCCAAACGGATGTACAC AGCCAAAGTTGTG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAGTTGGGACGTGTAAAACAAATATCATCGTCTTGATGAAGTTATGGAGTTATAGTTGTGGGACTCGTTTTTTTTACATAATGGATTAAACCGGCCTCT[ACATCCAAACGGATGTACACAGCCAAAGTTGTG/GCATCCAAACGGATGTACACAGCCAAAGTTGTG,A]
GGACTCATTTTAGTCGAGATAAATTCAAATGACACCTAAAATTAAAGATGGCCTTGTGAATTCTTACTCTGGAATACTCGGTGCAGAGACTGAGAATTAT

Reverse complement sequence

ATAATTCTCAGTCTCTGCACCGAGTATTCCAGAGTAAGAATTCACAAGGCCATCTTTAATTTTAGGTGTCATTTGAATTTATCTCGACTAAAATGAGTCC[CACAACTTTGGCTGTGTACATCCGTTTGGATGT/CACAACTTTGGCTGTGTACATCCGTTTGGATGC,T]
AGAGGCCGGTTTAATCCATTATGTAAAAAAAACGAGTCCCACAACTATAACTCCATAACTTCATCAAGACGATGATATTTGTTTTACACGTCCCAACTCT

Allele Frequencies:

Populations	Population Size	Frequency of ACATCCAAACGGATGTACAC AGCCAAAGTTGTG(primary allele)	Frequency of GCATCCAAACGGATGTACAC AGCCAAAGTTGTG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	11.20%	1.25%	14.71%	A: 4.34%
All Indica	2759	53.80%	18.40%	2.10%	18.81%	A: 6.92%
All Japonica	1512	87.50%	0.70%	0.07%	11.31%	A: 0.46%
Aus	269	99.30%	0.00%	0.00%	0.00%	A: 0.74%
Indica I	595	86.20%	6.70%	1.01%	4.54%	A: 1.51%
Indica II	465	19.40%	70.30%	3.01%	6.02%	A: 1.29%
Indica III	913	54.00%	0.20%	2.41%	28.59%	A: 14.79%
Indica Intermediate	786	49.40%	17.60%	2.04%	25.83%	A: 5.22%
Temperate Japonica	767	98.80%	0.30%	0.00%	0.00%	A: 0.91%
Tropical Japonica	504	67.70%	1.20%	0.20%	30.95%	NA
Japonica Intermediate	241	92.90%	0.80%	0.00%	6.22%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	1.04%	A: 1.04%
Intermediate	90	80.00%	11.10%	0.00%	4.44%	A: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> GCATCCAAACGGATGTACACAGCCAAAGTT GTG	LOC_Os08g30360.1	downstream_gene_variant ; 1370.0bp to feature; MODIFIER	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> GCATCCAAACGGATGTACACAGCCAAAGTT GTG	LOC_Os08g30370.1	downstream_gene_variant ; 1874.0bp to feature; MODIFIER	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> GCATCCAAACGGATGTACACAGCCAAAGTT GTG	LOC_Os08g30360-LOC_Os08g30370	intergenic_region ; MODIFIER	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> A	LOC_Os08g30360.1	downstream_gene_variant ; 1371.0bp to feature; MODIFIER	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> A	LOC_Os08g30370.1	downstream_gene_variant ; 1873.0bp to feature; MODIFIER	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> A	LOC_Os08g30360-LOC_Os08g30370	intergenic_region ; MODIFIER	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N
vg0818684028	ACATCCAAACGGATGTACACAGCCAAAGTTGTG -> DEL	N	N	silent_mutation	Average:49.109; most accessible tissue: Callus, score: 88.353	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818684028	NA	1.91E-10	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818684028	NA	2.91E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	4.10E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.08E-11	mr1180	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	7.59E-08	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.88E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.61E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.95E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.57E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.84E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.16E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.58E-09	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	3.48E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.30E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.57E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.72E-12	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.22E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.61E-14	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	8.21E-08	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.71E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	9.69E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.55E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.33E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.54E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.69E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.64E-09	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.25E-06	mr1497_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.56E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	2.37E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	9.24E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	1.13E-12	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	6.68E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	7.87E-11	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.36E-11	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.23E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	3.74E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	3.57E-06	mr1893_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.63E-06	mr1928_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	3.11E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	5.63E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818684028	NA	7.56E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251