Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818658445:

Variant ID: vg0818658445 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18658445
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GGCACTTGATCAACAACACCTTTTTCCGGTGACTTCAAGATGGGGACGAGCTTGGAGAATCCATGGGGATGCCTAGCGTGCAAGACGCATTGTGCTGCCT[T/C]
CCGCTGCTAATCCGACCGCACTGTGCCACTGCTAACCCCGCTGCAATGCGCTGCCTCCTGTTGCTAATCTCATTGCCGAGGCCGCCACAACCGCTACCTC

Reverse complement sequence

GAGGTAGCGGTTGTGGCGGCCTCGGCAATGAGATTAGCAACAGGAGGCAGCGCATTGCAGCGGGGTTAGCAGTGGCACAGTGCGGTCGGATTAGCAGCGG[A/G]
AGGCAGCACAATGCGTCTTGCACGCTAGGCATCCCCATGGATTCTCCAAGCTCGTCCCCATCTTGAAGTCACCGGAAAAAGGTGTTGTTGATCAAGTGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	38.60%	0.02%	0.00%	NA
All Indica	2759	91.30%	8.70%	0.00%	0.00%	NA
All Japonica	1512	13.40%	86.60%	0.00%	0.00%	NA
Aus	269	50.90%	49.10%	0.00%	0.00%	NA
Indica I	595	83.20%	16.80%	0.00%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	87.50%	12.50%	0.00%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	34.70%	65.30%	0.00%	0.00%	NA
Japonica Intermediate	241	7.90%	92.10%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818658445	T -> C	LOC_Os08g30310.1	downstream_gene_variant ; 1333.0bp to feature; MODIFIER	silent_mutation	Average:59.478; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg0818658445	T -> C	LOC_Os08g30320.1	downstream_gene_variant ; 2757.0bp to feature; MODIFIER	silent_mutation	Average:59.478; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg0818658445	T -> C	LOC_Os08g30300-LOC_Os08g30310	intergenic_region ; MODIFIER	silent_mutation	Average:59.478; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818658445	NA	8.78E-07	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.32E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	8.41E-09	8.41E-09	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	3.35E-06	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	4.65E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	2.46E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	2.45E-07	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.58E-07	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.16E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.10E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.82E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	6.38E-08	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	8.04E-07	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	3.88E-07	3.88E-07	mr1623	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	7.75E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.16E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	3.99E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	2.42E-08	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	5.45E-10	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	4.77E-06	4.77E-06	mr1873	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	2.32E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	2.73E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	1.26E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818658445	NA	5.38E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251