Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818652211:

Variant ID: vg0818652211 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18652211
Reference Allele: CAlternative Allele: G,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACAGTGATAAATAATCTACCCTATAATTGAACAAATGGTTTTACTTATTTACTCATTCATCATGTCACACATCTAACGGTGTAAAATCATCTTATGAG[C/G,A]
TAGATCGAACGTGCCAGATGCACACGCGTGTCGCTCCTAATGCCGCAATCACGGGCTCACCGCGCCTCCTCCGCATCGGCCTCTCTCGAGCAGCACCTCG

Reverse complement sequence

CGAGGTGCTGCTCGAGAGAGGCCGATGCGGAGGAGGCGCGGTGAGCCCGTGATTGCGGCATTAGGAGCGACACGCGTGTGCATCTGGCACGTTCGATCTA[G/C,T]
CTCATAAGATGATTTTACACCGTTAGATGTGTGACATGATGAATGAGTAAATAAGTAAAACCATTTGTTCAATTATAGGGTAGATTATTTATCACTGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 15.00% 1.97% 2.77% A: 0.44%
All Indica  2759 67.10% 24.00% 3.37% 4.75% A: 0.76%
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 61.80% 13.10% 9.58% 15.46% NA
Indica II  465 20.20% 74.20% 3.23% 2.15% A: 0.22%
Indica III  913 91.00% 7.30% 0.22% 0.11% A: 1.31%
Indica Intermediate  786 71.10% 21.90% 2.42% 3.56% A: 1.02%
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818652211 C -> G LOC_Os08g30300-LOC_Os08g30310 intergenic_region ; MODIFIER silent_mutation Average:91.185; most accessible tissue: Zhenshan97 flag leaf, score: 95.842 N N N N
vg0818652211 C -> A LOC_Os08g30300-LOC_Os08g30310 intergenic_region ; MODIFIER silent_mutation Average:91.185; most accessible tissue: Zhenshan97 flag leaf, score: 95.842 N N N N
vg0818652211 C -> DEL N N silent_mutation Average:91.185; most accessible tissue: Zhenshan97 flag leaf, score: 95.842 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818652211 C A -0.03 -0.02 -0.03 -0.04 -0.03 -0.03
vg0818652211 C G -0.04 -0.03 -0.04 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818652211 NA 2.91E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 7.78E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.98E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 4.85E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 6.86E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.14E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 8.62E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 7.91E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 9.92E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.21E-10 mr1497_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 4.05E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.42E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 9.91E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 7.92E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 4.35E-13 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 4.93E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 3.11E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 2.17E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.14E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.27E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 9.54E-07 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 2.08E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818652211 NA 1.36E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251