\
| Variant ID: vg0818631289 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18631289 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 245. )
TCTGACCGATTGGACAATGTCGGTCTAACCGTGCTCCTCGAATTAAAACCCGATTTTTGCCAACGTCGTTTTGCAAAAGCAATTTCTCTTTCCTTTTTCT[G/A]
TTTATGGGCAAGTCAAACAAAAACCAACTAAATGTCCATCTTTTCCGCAAAAAGAACAAGTGTACTTTTCACGACAAGTTTGTGAAGTAGATTGTTTTGA
TCAAAACAATCTACTTCACAAACTTGTCGTGAAAAGTACACTTGTTCTTTTTGCGGAAAAGATGGACATTTAGTTGGTTTTTGTTTGACTTGCCCATAAA[C/T]
AGAAAAAGGAAAGAGAAATTGCTTTTGCAAAACGACGTTGGCAAAAATCGGGTTTTAATTCGAGGAGCACGGTTAGACCGACATTGTCCAATCGGTCAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 10.30% | 4.91% | 0.76% | NA |
| All Indica | 2759 | 83.00% | 10.10% | 6.92% | 0.00% | NA |
| All Japonica | 1512 | 81.90% | 13.40% | 2.25% | 2.38% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 1.00% | 2.35% | 0.00% | NA |
| Indica II | 465 | 94.60% | 2.40% | 3.01% | 0.00% | NA |
| Indica III | 913 | 72.10% | 18.60% | 9.31% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 11.70% | 9.92% | 0.00% | NA |
| Temperate Japonica | 767 | 91.30% | 0.00% | 4.04% | 4.69% | NA |
| Tropical Japonica | 504 | 63.50% | 36.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 8.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 4.40% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818631289 | G -> A | LOC_Os08g30280.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:35.445; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0818631289 | G -> A | LOC_Os08g30290.1 | downstream_gene_variant ; 1637.0bp to feature; MODIFIER | silent_mutation | Average:35.445; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0818631289 | G -> DEL | N | N | silent_mutation | Average:35.445; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818631289 | NA | 6.87E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | 7.00E-08 | 7.00E-08 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | 1.66E-06 | 2.65E-07 | mr1345 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | NA | 1.71E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | NA | 9.87E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | 1.79E-06 | 1.80E-06 | mr1511 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | NA | 5.62E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | NA | 2.75E-08 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | NA | 8.73E-09 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818631289 | NA | 5.03E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |