\
| Variant ID: vg0818628912 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18628912 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )
CTCTATCAACCACGTGCATCAATTCTAGCCTTAGTATCCCGCATGATATCTGACCACCACGAACATCGTCTTACCACTAAGCCGACTCCCGGTCCATCAC[T/C]
GCAAATACTCTCCCGAGGCATCAAGTCACCTACACATGAAACAAACAAAGAAACCATATTCCGAGACCAACCTATCACCAACTTGAGTCATTGTTAGCAA
TTGCTAACAATGACTCAAGTTGGTGATAGGTTGGTCTCGGAATATGGTTTCTTTGTTTGTTTCATGTGTAGGTGACTTGATGCCTCGGGAGAGTATTTGC[A/G]
GTGATGGACCGGGAGTCGGCTTAGTGGTAAGACGATGTTCGTGGTGGTCAGATATCATGCGGGATACTAAGGCTAGAATTGATGCACGTGGTTGATAGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 5.40% | 0.57% | 4.55% | NA |
| All Indica | 2759 | 91.60% | 2.30% | 0.54% | 5.58% | NA |
| All Japonica | 1512 | 86.90% | 12.40% | 0.60% | 0.07% | NA |
| Aus | 269 | 79.20% | 0.00% | 0.74% | 20.07% | NA |
| Indica I | 595 | 82.00% | 0.00% | 0.34% | 17.65% | NA |
| Indica II | 465 | 95.90% | 0.20% | 0.43% | 3.44% | NA |
| Indica III | 913 | 92.80% | 6.10% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 0.80% | 0.13% | 4.20% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.30% | 33.30% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 8.30% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818628912 | T -> C | LOC_Os08g30280.1 | missense_variant ; p.Ser200Gly; MODERATE | nonsynonymous_codon ; S200G | Average:29.088; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | unknown | unknown | TOLERATED | 1.00 |
| vg0818628912 | T -> DEL | LOC_Os08g30280.1 | N | frameshift_variant | Average:29.088; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818628912 | NA | 2.00E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 2.16E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | 1.87E-06 | 2.13E-06 | mr1266 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | 1.27E-08 | 1.27E-08 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 4.79E-07 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | 9.03E-06 | NA | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 1.92E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 1.63E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 6.70E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 5.05E-08 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 3.76E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | 8.63E-06 | 8.62E-06 | mr1873 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 1.56E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 1.27E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818628912 | NA | 4.99E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |