\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818610974:

Variant ID: vg0818610974 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18610974
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGGTTTTGTTTGTGATTAGGTGGTGGTCCTTCAGATCGTGTATGATACCAAACCTTCATTGGAGGCAAGTGCATGACGAACTAATTGTGTGATTCTT[A/G]
GAGTGTTTGCTCTATCTATTTATTTTCATTACATTTATGTGTGATATGTGATTGCATATGTTCAGATTGTTGTTCATGCTATTTAGATTTCAAGTTTATT

Reverse complement sequence

AATAAACTTGAAATCTAAATAGCATGAACAACAATCTGAACATATGCAATCACATATCACACATAAATGTAATGAAAATAAATAGATAGAGCAAACACTC[T/C]
AAGAATCACACAATTAGTTCGTCATGCACTTGCCTCCAATGAAGGTTTGGTATCATACACGATCTGAAGGACCACCACCTAATCACAAACAAAACCTCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 27.30% 0.74% 0.76% NA
All Indica  2759 59.80% 38.30% 1.05% 0.83% NA
All Japonica  1512 85.80% 14.20% 0.00% 0.00% NA
Aus  269 92.60% 1.50% 1.49% 4.46% NA
Indica I  595 60.20% 38.20% 1.51% 0.17% NA
Indica II  465 91.80% 7.30% 0.43% 0.43% NA
Indica III  913 37.20% 60.90% 0.55% 1.31% NA
Indica Intermediate  786 66.70% 30.70% 1.65% 1.02% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 63.10% 36.90% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818610974 A -> G LOC_Os08g30260-LOC_Os08g30270 intergenic_region ; MODIFIER silent_mutation Average:30.239; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N
vg0818610974 A -> DEL N N silent_mutation Average:30.239; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818610974 NA 2.00E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 7.13E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 4.00E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 3.70E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 2.16E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 3.99E-06 1.50E-06 mr1266 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 1.27E-08 1.27E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 4.79E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 9.03E-06 NA mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 1.63E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 6.70E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 5.05E-08 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 3.76E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 8.63E-06 8.62E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 1.56E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 1.27E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818610974 NA 4.99E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251