Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818605378:

Variant ID: vg0818605378 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18605378
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTAAGAATTTGCGATACATTGGATCTGAGAATTTTTAGAAGTTGAGATTCATTAGATTTGTGATGTATAATCTGTGATGATTTTTTTAAGAATTT[G/A]
GTATGTTTTTTCTTTTGATAATTTGTGATGTGAATATATGATTCATTGATTTCTGATGATACTTTGATTTTGATTTGGGAATATGTAGGGAGCAACTTGA

Reverse complement sequence

TCAAGTTGCTCCCTACATATTCCCAAATCAAAATCAAAGTATCATCAGAAATCAATGAATCATATATTCACATCACAAATTATCAAAAGAAAAAACATAC[C/T]
AAATTCTTAAAAAAATCATCACAGATTATACATCACAAATCTAATGAATCTCAACTTCTAAAAATTCTCAGATCCAATGTATCGCAAATTCTTAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.50%	0.04%	0.17%	NA
All Indica	2759	94.70%	4.90%	0.07%	0.29%	NA
All Japonica	1512	86.10%	13.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	98.50%	1.30%	0.00%	0.22%	NA
Indica III	913	88.50%	10.70%	0.22%	0.55%	NA
Indica Intermediate	786	95.80%	4.10%	0.00%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	62.70%	37.30%	0.00%	0.00%	NA
Japonica Intermediate	241	90.90%	9.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818605378	G -> A	LOC_Os08g30260.1	downstream_gene_variant ; 3556.0bp to feature; MODIFIER	silent_mutation	Average:37.202; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0818605378	G -> A	LOC_Os08g30260-LOC_Os08g30270	intergenic_region ; MODIFIER	silent_mutation	Average:37.202; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0818605378	G -> DEL	N	N	silent_mutation	Average:37.202; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818605378	NA	2.00E-06	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	2.16E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	7.72E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	1.27E-08	1.27E-08	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	1.55E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	4.79E-07	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	9.03E-06	NA	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	2.37E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	1.63E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	3.18E-06	NA	mr1450	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	3.75E-06	1.19E-06	mr1661	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	6.70E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	5.05E-08	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	6.14E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	3.76E-09	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	8.63E-06	8.62E-06	mr1873	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	1.56E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	1.27E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818605378	NA	4.99E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251