\
| Variant ID: vg0818604778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18604778 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTCCCGGTTCTATTAGGAACCTTCCATTAGGAACCGGGACTAAAGACTATTTTTAGTCCTGGTTAAAAACTTTTTGATGTTTAGTCCCGGTTGGTGTTAA[C/T]
CGGGACTAAAGATCATTTTTAGTCCTGGTTCAAAAAGTTGTCGGGTCGAGCCAGGCCCAATTATCTTTAGTCTCGATTGGTATAAACAACTGGGACTAAA
TTTAGTCCCAGTTGTTTATACCAATCGAGACTAAAGATAATTGGGCCTGGCTCGACCCGACAACTTTTTGAACCAGGACTAAAAATGATCTTTAGTCCCG[G/A]
TTAACACCAACCGGGACTAAACATCAAAAAGTTTTTAACCAGGACTAAAAATAGTCTTTAGTCCCGGTTCCTAATGGAAGGTTCCTAATAGAACCGGGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 16.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 57.10% | 42.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 70.80% | 28.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 46.60% | 53.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.30% | 64.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818604778 | C -> T | LOC_Os08g30260.1 | downstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:54.66; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| vg0818604778 | C -> T | LOC_Os08g30260-LOC_Os08g30270 | intergenic_region ; MODIFIER | silent_mutation | Average:54.66; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818604778 | NA | 2.81E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818604778 | NA | 1.04E-08 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818604778 | 1.95E-07 | NA | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818604778 | NA | 9.92E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |