\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818577705:

Variant ID: vg0818577705 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18577705
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.49, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCGCTCTTAAATGAACGAAGACTTGTGGCGGTCCTTCTCACGTGGAGGGAGCTCTCGATGATGCTTCGATGGGACGGGGCATACCTGCCCCCACTCC[A/G]
TCGGGTACAGGGTGGAATGTGGGGGCACGGCCGCCCGTCCGATCGGACGTGACCGGCGACATGCCGGTCACAGTCTGGTCACGCCTAATTGACGTGGGTC

Reverse complement sequence

GACCCACGTCAATTAGGCGTGACCAGACTGTGACCGGCATGTCGCCGGTCACGTCCGATCGGACGGGCGGCCGTGCCCCCACATTCCACCCTGTACCCGA[T/C]
GGAGTGGGGGCAGGTATGCCCCGTCCCATCGAAGCATCATCGAGAGCTCCCTCCACGTGAGAAGGACCGCCACAAGTCTTCGTTCATTTAAGAGCGAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 38.20% 0.02% 0.00% NA
All Indica  2759 91.80% 8.20% 0.00% 0.00% NA
All Japonica  1512 13.10% 86.90% 0.00% 0.00% NA
Aus  269 49.40% 50.20% 0.37% 0.00% NA
Indica I  595 84.00% 16.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 11.20% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 33.70% 66.30% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818577705 A -> G LOC_Os08g30220.1 upstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:73.256; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N
vg0818577705 A -> G LOC_Os08g30230.1 upstream_gene_variant ; 3929.0bp to feature; MODIFIER silent_mutation Average:73.256; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N
vg0818577705 A -> G LOC_Os08g30240.1 upstream_gene_variant ; 4470.0bp to feature; MODIFIER silent_mutation Average:73.256; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N
vg0818577705 A -> G LOC_Os08g30220-LOC_Os08g30230 intergenic_region ; MODIFIER silent_mutation Average:73.256; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818577705 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818577705 NA 4.15E-07 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 1.49E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 1.25E-07 1.25E-07 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 1.04E-06 1.04E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 6.24E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 3.79E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 6.92E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 1.67E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 4.68E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 1.27E-07 2.21E-08 mr1509 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 2.91E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 9.32E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 6.58E-06 6.58E-06 mr1571 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 4.54E-07 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 3.71E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 1.56E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 3.23E-06 3.22E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577705 NA 2.63E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251