\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818577415:

Variant ID: vg0818577415 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18577415
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTCGGAAATTACTAGTGAATTTCCGGGCGTGACAGGAGAGCACTCTCGCTCTTCTTCTCCTAGGGTTTGGGCTTCCTGATAGTCGTCCCCCTTCTCGT[C/T]
GGGCAAGGTCCTCCTTTTATAGTTCAAGGGGATACCACATGCACCGCCTCTACCCACTCTTTCATGGGAGGAGGACCCACTCTACTTAGACCGAACCACG

Reverse complement sequence

CGTGGTTCGGTCTAAGTAGAGTGGGTCCTCCTCCCATGAAAGAGTGGGTAGAGGCGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAGGACCTTGCCC[G/A]
ACGAGAAGGGGGACGACTATCAGGAAGCCCAAACCCTAGGAGAAGAAGAGCGAGAGTGCTCTCCTGTCACGCCCGGAAATTCACTAGTAATTTCCGAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 19.40% 0.13% 0.00% NA
All Indica  2759 75.90% 24.10% 0.07% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 13.80% 84.80% 1.49% 0.00% NA
Indica I  595 95.10% 4.70% 0.17% 0.00% NA
Indica II  465 88.00% 12.00% 0.00% 0.00% NA
Indica III  913 63.70% 36.30% 0.00% 0.00% NA
Indica Intermediate  786 68.20% 31.70% 0.13% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818577415 C -> T LOC_Os08g30220.1 upstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0818577415 C -> T LOC_Os08g30230.1 upstream_gene_variant ; 4219.0bp to feature; MODIFIER silent_mutation Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0818577415 C -> T LOC_Os08g30240.1 upstream_gene_variant ; 4760.0bp to feature; MODIFIER silent_mutation Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0818577415 C -> T LOC_Os08g30220-LOC_Os08g30230 intergenic_region ; MODIFIER silent_mutation Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818577415 NA 6.96E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 2.57E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 4.06E-10 mr1320 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 5.65E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 7.46E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 7.67E-07 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 9.99E-08 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 4.08E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 2.77E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 5.82E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415 NA 1.28E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251