Variant ID: vg0818577415 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 18577415 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTCGGAAATTACTAGTGAATTTCCGGGCGTGACAGGAGAGCACTCTCGCTCTTCTTCTCCTAGGGTTTGGGCTTCCTGATAGTCGTCCCCCTTCTCGT[C/T]
GGGCAAGGTCCTCCTTTTATAGTTCAAGGGGATACCACATGCACCGCCTCTACCCACTCTTTCATGGGAGGAGGACCCACTCTACTTAGACCGAACCACG
CGTGGTTCGGTCTAAGTAGAGTGGGTCCTCCTCCCATGAAAGAGTGGGTAGAGGCGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAGGACCTTGCCC[G/A]
ACGAGAAGGGGGACGACTATCAGGAAGCCCAAACCCTAGGAGAAGAAGAGCGAGAGTGCTCTCCTGTCACGCCCGGAAATTCACTAGTAATTTCCGAACT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 80.40% | 19.40% | 0.13% | 0.00% | NA |
All Indica | 2759 | 75.90% | 24.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 13.80% | 84.80% | 1.49% | 0.00% | NA |
Indica I | 595 | 95.10% | 4.70% | 0.17% | 0.00% | NA |
Indica II | 465 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 63.70% | 36.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 68.20% | 31.70% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0818577415 | C -> T | LOC_Os08g30220.1 | upstream_gene_variant ; 872.0bp to feature; MODIFIER | silent_mutation | Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
vg0818577415 | C -> T | LOC_Os08g30230.1 | upstream_gene_variant ; 4219.0bp to feature; MODIFIER | silent_mutation | Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
vg0818577415 | C -> T | LOC_Os08g30240.1 | upstream_gene_variant ; 4760.0bp to feature; MODIFIER | silent_mutation | Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
vg0818577415 | C -> T | LOC_Os08g30220-LOC_Os08g30230 | intergenic_region ; MODIFIER | silent_mutation | Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0818577415 | NA | 6.96E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 2.57E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 4.06E-10 | mr1320 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 5.65E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 7.46E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 7.67E-07 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 9.99E-08 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 4.08E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 2.77E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 5.82E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818577415 | NA | 1.28E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |