Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818577415:

Variant ID: vg0818577415 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18577415
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTCGGAAATTACTAGTGAATTTCCGGGCGTGACAGGAGAGCACTCTCGCTCTTCTTCTCCTAGGGTTTGGGCTTCCTGATAGTCGTCCCCCTTCTCGT[C/T]
GGGCAAGGTCCTCCTTTTATAGTTCAAGGGGATACCACATGCACCGCCTCTACCCACTCTTTCATGGGAGGAGGACCCACTCTACTTAGACCGAACCACG

Reverse complement sequence

CGTGGTTCGGTCTAAGTAGAGTGGGTCCTCCTCCCATGAAAGAGTGGGTAGAGGCGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAGGACCTTGCCC[G/A]
ACGAGAAGGGGGACGACTATCAGGAAGCCCAAACCCTAGGAGAAGAAGAGCGAGAGTGCTCTCCTGTCACGCCCGGAAATTCACTAGTAATTTCCGAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	19.40%	0.13%	0.00%	NA
All Indica	2759	75.90%	24.10%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	13.80%	84.80%	1.49%	0.00%	NA
Indica I	595	95.10%	4.70%	0.17%	0.00%	NA
Indica II	465	88.00%	12.00%	0.00%	0.00%	NA
Indica III	913	63.70%	36.30%	0.00%	0.00%	NA
Indica Intermediate	786	68.20%	31.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818577415	C -> T	LOC_Os08g30220.1	upstream_gene_variant ; 872.0bp to feature; MODIFIER	silent_mutation	Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg0818577415	C -> T	LOC_Os08g30230.1	upstream_gene_variant ; 4219.0bp to feature; MODIFIER	silent_mutation	Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg0818577415	C -> T	LOC_Os08g30240.1	upstream_gene_variant ; 4760.0bp to feature; MODIFIER	silent_mutation	Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg0818577415	C -> T	LOC_Os08g30220-LOC_Os08g30230	intergenic_region ; MODIFIER	silent_mutation	Average:56.122; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818577415	NA	6.96E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	2.57E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	4.06E-10	mr1320	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	5.65E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	7.46E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	7.67E-07	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	9.99E-08	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	4.08E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	2.77E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	5.82E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577415	NA	1.28E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251