Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818558485:

Variant ID: vg0818558485 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18558485
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.39, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGGCAGCCAGACAGACGAGGAGTAGAGGAGGCAGTCTTCAGCAGCCGTCCGTGTGTTAGGCCCTTTTGTTCCGCCGCCAACTCTTTTGGAGTCGTGGC[A/G]
AGATAGTGCGTGCGTGCGTGTGTTTGATGTGGGTGTTGTTTGGTAGTCTGGTTCTCCTAGGTGGTGTGCGCACAGTCAAGCTCGGCGTAGCTCTGTGACT

Reverse complement sequence

AGTCACAGAGCTACGCCGAGCTTGACTGTGCGCACACCACCTAGGAGAACCAGACTACCAAACAACACCCACATCAAACACACGCACGCACGCACTATCT[T/C]
GCCACGACTCCAAAAGAGTTGGCGGCGGAACAAAAGGGCCTAACACACGGACGGCTGCTGAAGACTGCCTCCTCTACTCCTCGTCTGTCTGGCTGCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.30%	28.90%	32.42%	8.32%	NA
All Indica	2759	21.30%	21.20%	51.18%	6.38%	NA
All Japonica	1512	46.80%	40.70%	0.93%	11.57%	NA
Aus	269	7.40%	50.60%	31.97%	10.04%	NA
Indica I	595	15.80%	21.00%	47.56%	15.63%	NA
Indica II	465	72.50%	9.90%	14.62%	3.01%	NA
Indica III	913	0.30%	26.80%	69.77%	3.07%	NA
Indica Intermediate	786	19.50%	21.40%	53.94%	5.22%	NA
Temperate Japonica	767	30.60%	68.60%	0.78%	0.00%	NA
Tropical Japonica	504	61.30%	6.50%	0.60%	31.55%	NA
Japonica Intermediate	241	67.60%	23.70%	2.07%	6.64%	NA
VI/Aromatic	96	81.20%	7.30%	5.21%	6.25%	NA
Intermediate	90	45.60%	27.80%	16.67%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818558485	A -> G	LOC_Os08g30180.1	upstream_gene_variant ; 3933.0bp to feature; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Zhenshan97 flag leaf, score: 80.156	N	N	N	N
vg0818558485	A -> G	LOC_Os08g30200.1	upstream_gene_variant ; 3685.0bp to feature; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Zhenshan97 flag leaf, score: 80.156	N	N	N	N
vg0818558485	A -> G	LOC_Os08g30190.1	intron_variant ; MODIFIER	silent_mutation	Average:57.019; most accessible tissue: Zhenshan97 flag leaf, score: 80.156	N	N	N	N
vg0818558485	A -> DEL	N	N	silent_mutation	Average:57.019; most accessible tissue: Zhenshan97 flag leaf, score: 80.156	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818558485	2.12E-06	NA	mr1161_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818558485	NA	4.17E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818558485	NA	5.63E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818558485	NA	3.27E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818558485	NA	2.60E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818558485	NA	4.38E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251