\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818521526:

Variant ID: vg0818521526 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18521526
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCTAGCGAAAATAGATCTTCTCTAGCGGCTGGACTCCGCCAGAGAAAACTATACATCTTCACTGGCCTTTACTCTCTGGCGGCTCCTACTACCGCCAG[T/C]
GAAAACCTGTTTTAGCCGCCACAAAAAACGTATTTCGTAGTAGTGAAAAGGAAAAGATCTAATCTCTAATCTATAACTACTTAAAAAATTTAAAAAGTTT

Reverse complement sequence

AAACTTTTTAAATTTTTTAAGTAGTTATAGATTAGAGATTAGATCTTTTCCTTTTCACTACTACGAAATACGTTTTTTGTGGCGGCTAAAACAGGTTTTC[A/G]
CTGGCGGTAGTAGGAGCCGCCAGAGAGTAAAGGCCAGTGAAGATGTATAGTTTTCTCTGGCGGAGTCCAGCCGCTAGAGAAGATCTATTTTCGCTAGCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 42.40% 0.49% 1.88% NA
All Indica  2759 31.50% 64.60% 0.72% 3.19% NA
All Japonica  1512 87.50% 12.50% 0.00% 0.00% NA
Aus  269 95.90% 3.30% 0.74% 0.00% NA
Indica I  595 30.80% 68.70% 0.50% 0.00% NA
Indica II  465 80.60% 19.10% 0.22% 0.00% NA
Indica III  913 4.40% 86.60% 0.88% 8.11% NA
Indica Intermediate  786 34.60% 62.60% 1.02% 1.78% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 67.90% 32.10% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818521526 T -> C LOC_Os08g30120.1 downstream_gene_variant ; 933.0bp to feature; MODIFIER silent_mutation Average:51.682; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0818521526 T -> C LOC_Os08g30120-LOC_Os08g30140 intergenic_region ; MODIFIER silent_mutation Average:51.682; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0818521526 T -> DEL N N silent_mutation Average:51.682; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818521526 2.28E-06 5.20E-08 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 2.28E-06 2.28E-06 mr1058 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 3.06E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 2.00E-08 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 6.45E-09 6.45E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 8.03E-08 8.03E-08 mr1299 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 7.46E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 8.23E-08 2.50E-09 mr1345 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 6.06E-07 5.89E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 8.50E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.55E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 1.49E-06 1.49E-06 mr1417 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 4.68E-06 4.76E-07 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 4.29E-06 4.29E-06 mr1485 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 5.41E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.84E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 2.22E-07 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 5.88E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 3.27E-06 2.38E-08 mr1700 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 2.04E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 3.40E-07 3.40E-07 mr1756 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 6.83E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 2.79E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 7.12E-07 7.12E-07 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 9.55E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 2.44E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 7.44E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.33E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 5.14E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.32E-08 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 5.38E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 6.14E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 2.44E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 5.54E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.61E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.75E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 7.38E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 9.41E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.33E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 1.80E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 7.31E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818521526 NA 6.03E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251