\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818493390:

Variant ID: vg0818493390 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18493390
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.19, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATATAAACCTCAACAACCAACGTGGATTGTGGCGCAAAACGGTAATCCCTCTTTTTCGTATTGTAAATCGCTTTTGATACATTGATATTGTTTTTCCAT[G/A]
TAACTAGCATGGTGGCCCGCGGATTGCGCGGCTAGCATTATTATATTTTCTCTCATATAATAGCATATGTGTTTTCTTATTATATTATTCAAATATATTA

Reverse complement sequence

TAATATATTTGAATAATATAATAAGAAAACACATATGCTATTATATGAGAGAAAATATAATAATGCTAGCCGCGCAATCCGCGGGCCACCATGCTAGTTA[C/T]
ATGGAAAAACAATATCAATGTATCAAAAGCGATTTACAATACGAAAAAGAGGGATTACCGTTTTGCGCCACAATCCACGTTGGTTGTTGAGGTTTATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 16.60% 0.40% 0.00% NA
All Indica  2759 78.10% 21.30% 0.54% 0.00% NA
All Japonica  1512 87.90% 12.00% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 91.20% 8.20% 0.65% 0.00% NA
Indica III  913 65.30% 34.20% 0.55% 0.00% NA
Indica Intermediate  786 72.40% 26.70% 0.89% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 69.00% 30.60% 0.40% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818493390 G -> A LOC_Os08g30080.1 upstream_gene_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:81.199; most accessible tissue: Zhenshan97 flower, score: 88.135 N N N N
vg0818493390 G -> A LOC_Os08g30090.1 downstream_gene_variant ; 3579.0bp to feature; MODIFIER silent_mutation Average:81.199; most accessible tissue: Zhenshan97 flower, score: 88.135 N N N N
vg0818493390 G -> A LOC_Os08g30080-LOC_Os08g30090 intergenic_region ; MODIFIER silent_mutation Average:81.199; most accessible tissue: Zhenshan97 flower, score: 88.135 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818493390 G A -0.04 -0.03 -0.03 -0.02 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818493390 NA 1.66E-07 Yield Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818493390 NA 5.20E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 6.51E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 3.36E-08 3.36E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 2.98E-06 2.98E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 9.97E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 4.27E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 1.88E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 3.15E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 3.93E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 1.46E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 2.26E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818493390 NA 6.36E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251