\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818396700:

Variant ID: vg0818396700 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18396700
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, G: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTATATAAGGTGAGCAGGGAGCCCCTTCTAAGGGGCATCAGCACTGAGATTCTTTTCTTTTGCGGGGATGAGCACAGAGATTCACAATCAGATCTCGTCA[C/G]
ATCAATACTATACCCGACAGATTCAAATCTCCAAACATGAGTATGGTATTACCTCTCATCCAGAGGGTCTGAACCTGTCTAAATCCTTCTCTCTGCATCC

Reverse complement sequence

GGATGCAGAGAGAAGGATTTAGACAGGTTCAGACCCTCTGGATGAGAGGTAATACCATACTCATGTTTGGAGATTTGAATCTGTCGGGTATAGTATTGAT[G/C]
TGACGAGATCTGATTGTGAATCTCTGTGCTCATCCCCGCAAAAGAAAAGAATCTCAGTGCTGATGCCCCTTAGAAGGGGCTCCCTGCTCACCTTATATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 43.80% 0.15% 3.72% NA
All Indica  2759 29.70% 67.50% 0.14% 2.68% NA
All Japonica  1512 89.40% 4.00% 0.13% 6.48% NA
Aus  269 57.60% 42.00% 0.37% 0.00% NA
Indica I  595 28.60% 70.80% 0.34% 0.34% NA
Indica II  465 77.80% 21.70% 0.00% 0.43% NA
Indica III  913 4.10% 89.60% 0.11% 6.24% NA
Indica Intermediate  786 31.80% 66.40% 0.13% 1.65% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 73.80% 6.50% 0.40% 19.25% NA
Japonica Intermediate  241 90.50% 9.10% 0.00% 0.41% NA
VI/Aromatic  96 89.60% 8.30% 0.00% 2.08% NA
Intermediate  90 66.70% 31.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818396700 C -> G LOC_Os08g29940.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:65.893; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N
vg0818396700 C -> G LOC_Os08g29950.1 upstream_gene_variant ; 1663.0bp to feature; MODIFIER silent_mutation Average:65.893; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N
vg0818396700 C -> G LOC_Os08g29940-LOC_Os08g29950 intergenic_region ; MODIFIER silent_mutation Average:65.893; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N
vg0818396700 C -> DEL N N silent_mutation Average:65.893; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818396700 NA 9.82E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 1.16E-08 1.16E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 2.29E-06 2.29E-06 mr1339 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 7.18E-06 7.18E-06 mr1513 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 1.06E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 4.21E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 4.51E-06 4.50E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 7.46E-07 7.46E-07 mr1881 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 5.13E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 6.89E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 2.56E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 3.29E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 5.01E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 4.02E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818396700 NA 8.83E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251