Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818395231:

Variant ID: vg0818395231 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18395231
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATACACGTCATATTTTAAGGGTTTCGGTGGGCATATTTTGGGCCTAGGCCTAATATGTCTATAGGGAAACAGTTGGAAACGATTGGAATCGATAGCAT[C/T]
TCTTCGGAAATGATGCTCGAATGGCCAATAATTGACCATATTTATCATTTAAACTACTCAGTGTCAACATTAATATGATGCAGAAAGAAATTAGAAAAAA

Reverse complement sequence

TTTTTTCTAATTTCTTTCTGCATCATATTAATGTTGACACTGAGTAGTTTAAATGATAAATATGGTCAATTATTGGCCATTCGAGCATCATTTCCGAAGA[G/A]
ATGCTATCGATTCCAATCGTTTCCAACTGTTTCCCTATAGACATATTAGGCCTAGGCCCAAAATATGCCCACCGAAACCCTTAAAATATGACGTGTATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	9.60%	0.32%	3.28%	NA
All Indica	2759	85.90%	11.60%	0.43%	2.03%	NA
All Japonica	1512	92.70%	0.80%	0.20%	6.28%	NA
Aus	269	61.00%	39.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.20%	0.34%	0.00%	NA
Indica II	465	92.00%	7.70%	0.00%	0.22%	NA
Indica III	913	71.90%	22.30%	1.10%	4.71%	NA
Indica Intermediate	786	89.10%	9.40%	0.00%	1.53%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	80.60%	0.20%	0.60%	18.65%	NA
Japonica Intermediate	241	97.50%	2.10%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	6.20%	0.00%	2.08%	NA
Intermediate	90	84.40%	13.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818395231	C -> T	LOC_Os08g29930.1	upstream_gene_variant ; 3840.0bp to feature; MODIFIER	silent_mutation	Average:46.815; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0818395231	C -> T	LOC_Os08g29940.1	upstream_gene_variant ; 313.0bp to feature; MODIFIER	silent_mutation	Average:46.815; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0818395231	C -> T	LOC_Os08g29950.1	upstream_gene_variant ; 3132.0bp to feature; MODIFIER	silent_mutation	Average:46.815; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0818395231	C -> T	LOC_Os08g29940-LOC_Os08g29950	intergenic_region ; MODIFIER	silent_mutation	Average:46.815; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0818395231	C -> DEL	N	N	silent_mutation	Average:46.815; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818395231	NA	3.04E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818395231	NA	3.45E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818395231	NA	2.12E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818395231	1.01E-06	1.56E-09	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818395231	2.50E-06	2.50E-06	mr1836	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251