Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818393811:

Variant ID: vg0818393811 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18393811
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTAACTTAAATTTGAGAAACTTTCTACTCAAATTCAAACTCTCAACTGATATTGAAGGTGATAGATTGAATTTATAAAATATAAAAAAAATATCATG[T/C]
GTGTGTGTTATTCTACTACAACAAGTGGTGCTCCAATCTTCAAGATTTATACTCGGACGTCCTCAACACGTATCTTTACTCAATTAATGACGAAAAGAAG

Reverse complement sequence

CTTCTTTTCGTCATTAATTGAGTAAAGATACGTGTTGAGGACGTCCGAGTATAAATCTTGAAGATTGGAGCACCACTTGTTGTAGTAGAATAACACACAC[A/G]
CATGATATTTTTTTTATATTTTATAAATTCAATCTATCACCTTCAATATCAGTTGAGAGTTTGAATTTGAGTAGAAAGTTTCTCAAATTTAAGTTAAATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.90%	44.30%	0.11%	3.72%	NA
All Indica	2759	29.80%	67.60%	0.04%	2.65%	NA
All Japonica	1512	87.90%	5.40%	0.20%	6.55%	NA
Aus	269	58.00%	41.60%	0.37%	0.00%	NA
Indica I	595	28.70%	70.90%	0.00%	0.34%	NA
Indica II	465	77.60%	21.70%	0.22%	0.43%	NA
Indica III	913	4.20%	89.60%	0.00%	6.24%	NA
Indica Intermediate	786	31.90%	66.50%	0.00%	1.53%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	72.80%	7.10%	0.60%	19.44%	NA
Japonica Intermediate	241	86.70%	12.90%	0.00%	0.41%	NA
VI/Aromatic	96	89.60%	8.30%	0.00%	2.08%	NA
Intermediate	90	65.60%	32.20%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818393811	T -> C	LOC_Os08g29930.1	upstream_gene_variant ; 2420.0bp to feature; MODIFIER	silent_mutation	Average:21.277; most accessible tissue: Callus, score: 47.347	N	N	N	N
vg0818393811	T -> C	LOC_Os08g29950.1	upstream_gene_variant ; 4552.0bp to feature; MODIFIER	silent_mutation	Average:21.277; most accessible tissue: Callus, score: 47.347	N	N	N	N
vg0818393811	T -> C	LOC_Os08g29940.1	downstream_gene_variant ; 738.0bp to feature; MODIFIER	silent_mutation	Average:21.277; most accessible tissue: Callus, score: 47.347	N	N	N	N
vg0818393811	T -> C	LOC_Os08g29930-LOC_Os08g29940	intergenic_region ; MODIFIER	silent_mutation	Average:21.277; most accessible tissue: Callus, score: 47.347	N	N	N	N
vg0818393811	T -> DEL	N	N	silent_mutation	Average:21.277; most accessible tissue: Callus, score: 47.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818393811	4.42E-06	4.42E-06	mr1153	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	2.50E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	8.65E-07	8.65E-07	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	9.74E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	9.21E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	3.45E-06	3.45E-06	mr1601	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	4.27E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	8.19E-07	mr1866	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	2.47E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	6.04E-09	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	4.96E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	1.44E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	7.88E-06	mr1421_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	1.30E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	2.70E-09	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	4.08E-06	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	3.78E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818393811	NA	7.51E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251