\
| Variant ID: vg0818303489 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18303489 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGTGTTACCAACCGGGACTAAAGATCGGTCAGCCACGTGGCCGGCCGAACCACCTTTAGTCCCGGTTTGTGTTACCAACCAGAACTAAAGATCGGTGCAC[T/C]
ATTTTTTTTATTTGCATGGCCCTGTTTTTTTTTTTGTTTTTTTATTTGCATGGCCCTGTTTGATTATCTTTAGCCACGTAACTTTTGCTGCACTAAAGTT
AACTTTAGTGCAGCAAAAGTTACGTGGCTAAAGATAATCAAACAGGGCCATGCAAATAAAAAAACAAAAAAAAAAACAGGGCCATGCAAATAAAAAAAAT[A/G]
GTGCACCGATCTTTAGTTCTGGTTGGTAACACAAACCGGGACTAAAGGTGGTTCGGCCGGCCACGTGGCTGACCGATCTTTAGTCCCGGTTGGTAACACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 16.80% | 3.60% | 28.71% | NA |
| All Indica | 2759 | 24.10% | 21.70% | 5.98% | 48.28% | NA |
| All Japonica | 1512 | 87.70% | 11.60% | 0.20% | 0.46% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.37% | 0.37% | NA |
| Indica I | 595 | 49.40% | 6.10% | 3.19% | 41.34% | NA |
| Indica II | 465 | 28.00% | 6.50% | 14.62% | 50.97% | NA |
| Indica III | 913 | 4.20% | 36.80% | 3.72% | 55.31% | NA |
| Indica Intermediate | 786 | 25.70% | 24.90% | 5.60% | 43.77% | NA |
| Temperate Japonica | 767 | 98.60% | 0.80% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 67.70% | 31.70% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 15.60% | 1.11% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818303489 | T -> C | LOC_Os08g29770.1 | upstream_gene_variant ; 1875.0bp to feature; MODIFIER | silent_mutation | Average:48.456; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg0818303489 | T -> C | LOC_Os08g29760.1 | downstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:48.456; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg0818303489 | T -> C | LOC_Os08g29760-LOC_Os08g29770 | intergenic_region ; MODIFIER | silent_mutation | Average:48.456; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| vg0818303489 | T -> DEL | N | N | silent_mutation | Average:48.456; most accessible tissue: Zhenshan97 flower, score: 69.089 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818303489 | NA | 2.74E-08 | Yield | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0818303489 | NA | 5.51E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818303489 | NA | 1.90E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |