\
| Variant ID: vg0818260770 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18260770 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
ATACTAAACAAGCCAAGCTCAAGTCTAGGCTGAGGCTCGCAAGCCTAGTAAGTTCGAACTCGAATAGCTCGGCAAGGCTTGATTAGTATAAGATGCATTG[C/T]
ATTTAGGAAGATATTCTTAATGGATCAATATATACTTGTCATCGTGCTTGATCTGTTTAAGTCTTAAGAACTCATCAATGCTTCTCAATAAAGCAATTAT
ATAATTGCTTTATTGAGAAGCATTGATGAGTTCTTAAGACTTAAACAGATCAAGCACGATGACAAGTATATATTGATCCATTAAGAATATCTTCCTAAAT[G/A]
CAATGCATCTTATACTAATCAAGCCTTGCCGAGCTATTCGAGTTCGAACTTACTAGGCTTGCGAGCCTCAGCCTAGACTTGAGCTTGGCTTGTTTAGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 40.70% | 59.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818260770 | C -> T | LOC_Os08g29730.1 | upstream_gene_variant ; 4877.0bp to feature; MODIFIER | silent_mutation | Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0818260770 | C -> T | LOC_Os08g29720.1 | downstream_gene_variant ; 3259.0bp to feature; MODIFIER | silent_mutation | Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0818260770 | C -> T | LOC_Os08g29720.2 | downstream_gene_variant ; 3205.0bp to feature; MODIFIER | silent_mutation | Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0818260770 | C -> T | LOC_Os08g29720-LOC_Os08g29730 | intergenic_region ; MODIFIER | silent_mutation | Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818260770 | 5.31E-07 | NA | Grain_width | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0818260770 | NA | 6.59E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818260770 | NA | 1.08E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818260770 | NA | 2.13E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818260770 | NA | 9.30E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818260770 | NA | 1.15E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |