\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818260770:

Variant ID: vg0818260770 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18260770
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTAAACAAGCCAAGCTCAAGTCTAGGCTGAGGCTCGCAAGCCTAGTAAGTTCGAACTCGAATAGCTCGGCAAGGCTTGATTAGTATAAGATGCATTG[C/T]
ATTTAGGAAGATATTCTTAATGGATCAATATATACTTGTCATCGTGCTTGATCTGTTTAAGTCTTAAGAACTCATCAATGCTTCTCAATAAAGCAATTAT

Reverse complement sequence

ATAATTGCTTTATTGAGAAGCATTGATGAGTTCTTAAGACTTAAACAGATCAAGCACGATGACAAGTATATATTGATCCATTAAGAATATCTTCCTAAAT[G/A]
CAATGCATCTTATACTAATCAAGCCTTGCCGAGCTATTCGAGTTCGAACTTACTAGGCTTGCGAGCCTCAGCCTAGACTTGAGCTTGGCTTGTTTAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 19.70% 0.00% 0.00% NA
All Indica  2759 93.50% 6.50% 0.00% 0.00% NA
All Japonica  1512 63.20% 36.80% 0.00% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 88.60% 11.40% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 90.10% 9.90% 0.00% 0.00% NA
Temperate Japonica  767 81.60% 18.40% 0.00% 0.00% NA
Tropical Japonica  504 40.70% 59.30% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818260770 C -> T LOC_Os08g29730.1 upstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0818260770 C -> T LOC_Os08g29720.1 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0818260770 C -> T LOC_Os08g29720.2 downstream_gene_variant ; 3205.0bp to feature; MODIFIER silent_mutation Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0818260770 C -> T LOC_Os08g29720-LOC_Os08g29730 intergenic_region ; MODIFIER silent_mutation Average:62.434; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818260770 5.31E-07 NA Grain_width Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818260770 NA 6.59E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770 NA 1.08E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770 NA 2.13E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770 NA 9.30E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818260770 NA 1.15E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251