RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0818218008:

Variant ID: vg0818218008 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18218008
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTATGACCCATGATATATGTGTACGCATGTTTAGTATCAACTTAGTAGTTTAGTAAGAGTGGAACTAACTTATATGTAAGGGCTTGTCCCTTCAACCAT[A/T]
TCACTGCTGTGTTGACCCTTTTACACAAAGCGATGATAAAAGTATAAATGTGGTATGCCTGTTGGATGGACTGGCTACGTAGTTCTGAAGAGAGGGCTGT

Reverse complement sequence

ACAGCCCTCTCTTCAGAACTACGTAGCCAGTCCATCCAACAGGCATACCACATTTATACTTTTATCATCGCTTTGTGTAAAAGGGTCAACACAGCAGTGA[T/A]
ATGGTTGAAGGGACAAGCCCTTACATATAAGTTAGTTCCACTCTTACTAAACTACTAAGTTGATACTAAACATGCGTACACATATATCATGGGTCATACA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	8.70%	0.04%	0.00%	NA
All Indica	2759	94.20%	5.70%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	11.90%	88.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	94.40%	5.60%	0.00%	0.00%	NA
Indica Intermediate	786	89.30%	10.40%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818218008	A -> T	LOC_Os08g29660.1	upstream_gene_variant ; 2033.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723	N	N	N	N
vg0818218008	A -> T	LOC_Os08g29669.1	downstream_gene_variant ; 2636.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723	N	N	N	N
vg0818218008	A -> T	LOC_Os08g29650-LOC_Os08g29660	intergenic_region ; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818218008	NA	5.62E-16	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	5.98E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	2.75E-20	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	2.08E-16	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	1.21E-21	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	5.14E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	2.60E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	5.02E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	1.94E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008	NA	7.88E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 15 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0818218008:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact