Variant ID: vg0818218008 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 18218008 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGTATGACCCATGATATATGTGTACGCATGTTTAGTATCAACTTAGTAGTTTAGTAAGAGTGGAACTAACTTATATGTAAGGGCTTGTCCCTTCAACCAT[A/T]
TCACTGCTGTGTTGACCCTTTTACACAAAGCGATGATAAAAGTATAAATGTGGTATGCCTGTTGGATGGACTGGCTACGTAGTTCTGAAGAGAGGGCTGT
ACAGCCCTCTCTTCAGAACTACGTAGCCAGTCCATCCAACAGGCATACCACATTTATACTTTTATCATCGCTTTGTGTAAAAGGGTCAACACAGCAGTGA[T/A]
ATGGTTGAAGGGACAAGCCCTTACATATAAGTTAGTTCCACTCTTACTAAACTACTAAGTTGATACTAAACATGCGTACACATATATCATGGGTCATACA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.20% | 8.70% | 0.04% | 0.00% | NA |
All Indica | 2759 | 94.20% | 5.70% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 89.30% | 10.40% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0818218008 | A -> T | LOC_Os08g29660.1 | upstream_gene_variant ; 2033.0bp to feature; MODIFIER | silent_mutation | Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723 | N | N | N | N |
vg0818218008 | A -> T | LOC_Os08g29669.1 | downstream_gene_variant ; 2636.0bp to feature; MODIFIER | silent_mutation | Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723 | N | N | N | N |
vg0818218008 | A -> T | LOC_Os08g29650-LOC_Os08g29660 | intergenic_region ; MODIFIER | silent_mutation | Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0818218008 | NA | 5.62E-16 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 5.98E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 2.75E-20 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 2.08E-16 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 1.21E-21 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 5.14E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 2.60E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 5.02E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 1.94E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818218008 | NA | 7.88E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/