\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818218008:

Variant ID: vg0818218008 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18218008
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTATGACCCATGATATATGTGTACGCATGTTTAGTATCAACTTAGTAGTTTAGTAAGAGTGGAACTAACTTATATGTAAGGGCTTGTCCCTTCAACCAT[A/T]
TCACTGCTGTGTTGACCCTTTTACACAAAGCGATGATAAAAGTATAAATGTGGTATGCCTGTTGGATGGACTGGCTACGTAGTTCTGAAGAGAGGGCTGT

Reverse complement sequence

ACAGCCCTCTCTTCAGAACTACGTAGCCAGTCCATCCAACAGGCATACCACATTTATACTTTTATCATCGCTTTGTGTAAAAGGGTCAACACAGCAGTGA[T/A]
ATGGTTGAAGGGACAAGCCCTTACATATAAGTTAGTTCCACTCTTACTAAACTACTAAGTTGATACTAAACATGCGTACACATATATCATGGGTCATACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.70% 0.04% 0.00% NA
All Indica  2759 94.20% 5.70% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 89.30% 10.40% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818218008 A -> T LOC_Os08g29660.1 upstream_gene_variant ; 2033.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg0818218008 A -> T LOC_Os08g29669.1 downstream_gene_variant ; 2636.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg0818218008 A -> T LOC_Os08g29650-LOC_Os08g29660 intergenic_region ; MODIFIER silent_mutation Average:81.027; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818218008 NA 5.62E-16 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 5.98E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 2.75E-20 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 2.08E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 1.21E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 5.14E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 2.60E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 5.02E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 1.94E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 7.88E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 1.73E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 2.49E-12 mr1388_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 2.04E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 1.43E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818218008 NA 6.88E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251