\
| Variant ID: vg0818212763 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 18212763 |
| Reference Allele: AT | Alternative Allele: A,ATT,TT,ATTT |
| Primary Allele: AT | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTGATTGTCCATCTTATTTGAAATTTTTTATAATTAGTATTTTTATTATTATGAGATGATAAAACATGAATAGTACTTTATGCGTGACTTATGTTTTTA[AT/A,ATT,TT,ATTT]
TTTTTTTTCAAAATTTTTTTAAATAAGACGGACGATTAAAGTTGGGCACAGAAAATCATGGCTGCACTTAAAATGGGACGGATGGAGTAATTATTTCTAA
TTAGAAATAATTACTCCATCCGTCCCATTTTAAGTGCAGCCATGATTTTCTGTGCCCAACTTTAATCGTCCGTCTTATTTAAAAAAATTTTGAAAAAAAA[AT/T,AAT,AA,AAAT]
TAAAAACATAAGTCACGCATAAAGTACTATTCATGTTTTATCATCTCATAATAATAAAAATACTAATTATAAAAAATTTCAAATAAGATGGACAATCAAA
| Populations | Population Size | Frequency of AT(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 30.40% | 2.07% | 1.02% | TT: 5.67%; ATT: 2.79%; ATTT: 0.04% |
| All Indica | 2759 | 43.60% | 51.10% | 2.61% | 0.33% | TT: 2.21%; ATT: 0.14% |
| All Japonica | 1512 | 90.90% | 0.20% | 0.86% | 0.00% | ATT: 8.00%; TT: 0.07% |
| Aus | 269 | 10.80% | 0.70% | 3.35% | 12.27% | TT: 72.49%; ATT: 0.37% |
| Indica I | 595 | 56.10% | 43.40% | 0.34% | 0.00% | TT: 0.17% |
| Indica II | 465 | 84.10% | 11.40% | 3.23% | 0.00% | TT: 1.29% |
| Indica III | 913 | 18.90% | 76.60% | 2.30% | 0.22% | TT: 1.86%; ATT: 0.11% |
| Indica Intermediate | 786 | 38.70% | 51.00% | 4.33% | 0.89% | TT: 4.71%; ATT: 0.38% |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 75.00% | 0.00% | 2.38% | 0.00% | ATT: 22.62% |
| Japonica Intermediate | 241 | 95.90% | 0.40% | 0.41% | 0.00% | ATT: 2.90%; TT: 0.41% |
| VI/Aromatic | 96 | 85.40% | 1.00% | 1.04% | 3.12% | TT: 5.21%; ATTT: 2.08%; ATT: 2.08% |
| Intermediate | 90 | 62.20% | 20.00% | 3.33% | 3.33% | TT: 6.67%; ATT: 4.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818212763 | AT -> DEL | N | N | silent_mutation | Average:36.388; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0818212763 | AT -> ATTT | LOC_Os08g29650-LOC_Os08g29660 | intergenic_region ; MODIFIER | silent_mutation | Average:36.388; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0818212763 | AT -> A | LOC_Os08g29650-LOC_Os08g29660 | intergenic_region ; MODIFIER | silent_mutation | Average:36.388; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0818212763 | AT -> TT | LOC_Os08g29650-LOC_Os08g29660 | intergenic_region ; MODIFIER | silent_mutation | Average:36.388; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0818212763 | AT -> ATT | LOC_Os08g29650-LOC_Os08g29660 | intergenic_region ; MODIFIER | silent_mutation | Average:36.388; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818212763 | NA | 4.12E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 5.70E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 3.52E-25 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 2.59E-38 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 8.99E-34 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.03E-33 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 4.56E-07 | 2.69E-21 | mr1113 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 4.98E-08 | 9.38E-24 | mr1114 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 8.52E-07 | 2.05E-19 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 5.35E-09 | 1.64E-27 | mr1117 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 1.87E-07 | 2.09E-23 | mr1119 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 7.44E-06 | 2.25E-27 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 2.59E-09 | 1.22E-33 | mr1123 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.02E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 6.51E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 3.45E-06 | 3.20E-23 | mr1240 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 8.98E-08 | 2.17E-23 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 7.97E-07 | 1.77E-28 | mr1247 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 3.18E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 5.44E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 2.01E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 3.24E-07 | 8.44E-19 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 7.07E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.72E-26 | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 4.01E-08 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 9.45E-08 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 3.89E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 8.27E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.94E-33 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.73E-33 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.50E-31 | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 7.55E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 2.35E-19 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 6.26E-07 | 2.68E-27 | mr1917 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.69E-13 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.85E-22 | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.33E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 3.29E-22 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 5.08E-23 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.41E-37 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 5.46E-29 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 3.76E-08 | 3.97E-24 | mr1113_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 1.70E-08 | 1.42E-22 | mr1114_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 1.12E-08 | 4.33E-26 | mr1117_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 2.69E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 2.66E-08 | 3.93E-23 | mr1119_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 1.68E-08 | 1.78E-31 | mr1120_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 4.29E-09 | 4.00E-30 | mr1123_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 2.55E-07 | 4.85E-24 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 9.82E-08 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 8.50E-09 | 5.36E-31 | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 4.73E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 7.58E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 1.96E-07 | 5.61E-16 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 1.98E-15 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 8.60E-17 | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 4.11E-12 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 3.07E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | NA | 5.76E-19 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818212763 | 7.53E-06 | 3.86E-21 | mr1961_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |