\
| Variant ID: vg0818186893 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 18186893 |
| Reference Allele: CCA | Alternative Allele: TCA,C |
| Primary Allele: CCA | Secondary Allele: TCA |
Inferred Ancestral Allele: Not determined.
CTCTAAAATGTAATAAGTTCATAATACTCCATCCATCTACTTTTGATAGTCATATTTCATCTTGGCACACAGACCAACGATAAGTGATTCTACTTATCAT[CCA/TCA,C]
TTTAAACATGCTTCCATTTAAACATGCTACTAGTCATTCCTCGTGAACAAGCGATTCATTAATATTTACATTTCTCGATGCCCATGTAGCCAATCTTGTG
CACAAGATTGGCTACATGGGCATCGAGAAATGTAAATATTAATGAATCGCTTGTTCACGAGGAATGACTAGTAGCATGTTTAAATGGAAGCATGTTTAAA[TGG/TGA,G]
ATGATAAGTAGAATCACTTATCGTTGGTCTGTGTGCCAAGATGAAATATGACTATCAAAAGTAGATGGATGGAGTATTATGAACTTATTACATTTTAGAG
| Populations | Population Size | Frequency of CCA(primary allele) | Frequency of TCA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 1.50% | 2.18% | 17.69% | C: 0.13% |
| All Indica | 2759 | 70.40% | 0.60% | 1.88% | 27.04% | C: 0.11% |
| All Japonica | 1512 | 95.80% | 0.00% | 0.20% | 3.90% | C: 0.13% |
| Aus | 269 | 58.40% | 19.00% | 15.99% | 6.69% | NA |
| Indica I | 595 | 61.50% | 0.00% | 1.18% | 36.81% | C: 0.50% |
| Indica II | 465 | 24.70% | 0.20% | 2.15% | 72.90% | NA |
| Indica III | 913 | 97.90% | 0.70% | 1.31% | 0.11% | NA |
| Indica Intermediate | 786 | 72.10% | 1.10% | 2.93% | 23.79% | NA |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.13% | 1.04% | C: 0.26% |
| Tropical Japonica | 504 | 93.50% | 0.00% | 0.20% | 6.35% | NA |
| Japonica Intermediate | 241 | 91.70% | 0.00% | 0.41% | 7.88% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 1.10% | 4.44% | 14.44% | C: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818186893 | CCA -> C | LOC_Os08g29650.1 | upstream_gene_variant ; 2512.0bp to feature; MODIFIER | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| vg0818186893 | CCA -> C | LOC_Os08g29640.1 | downstream_gene_variant ; 1416.0bp to feature; MODIFIER | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| vg0818186893 | CCA -> C | LOC_Os08g29640-LOC_Os08g29650 | intergenic_region ; MODIFIER | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| vg0818186893 | CCA -> DEL | N | N | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| vg0818186893 | CCA -> TCA | LOC_Os08g29650.1 | upstream_gene_variant ; 2513.0bp to feature; MODIFIER | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| vg0818186893 | CCA -> TCA | LOC_Os08g29640.1 | downstream_gene_variant ; 1415.0bp to feature; MODIFIER | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| vg0818186893 | CCA -> TCA | LOC_Os08g29640-LOC_Os08g29650 | intergenic_region ; MODIFIER | silent_mutation | Average:25.2; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818186893 | NA | 3.40E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 5.54E-24 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 4.55E-37 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 3.61E-30 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.83E-30 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.49E-20 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.21E-22 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 7.42E-06 | 8.60E-20 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 6.32E-07 | 1.11E-26 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.73E-22 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 3.22E-26 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 2.46E-07 | 3.45E-33 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.65E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.99E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 9.54E-23 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.20E-21 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 4.20E-28 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 4.37E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.81E-06 | mr1349 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 3.42E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.13E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.77E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 8.83E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.70E-17 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 6.73E-27 | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.94E-08 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.30E-10 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 9.02E-08 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 5.18E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.17E-30 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.98E-30 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.36E-27 | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.69E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.21E-17 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.97E-26 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.57E-13 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 8.42E-23 | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.39E-21 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 6.89E-22 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 6.50E-38 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 8.02E-28 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 5.41E-06 | 3.82E-23 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 1.27E-06 | 1.55E-22 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 2.71E-07 | 8.52E-26 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 1.11E-06 | 8.21E-23 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 3.10E-07 | 2.43E-31 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 1.52E-07 | 3.91E-30 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.00E-23 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | 8.91E-08 | 1.07E-31 | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 4.80E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 4.97E-15 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 1.10E-30 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 5.19E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.58E-15 | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 9.87E-14 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 3.61E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 3.53E-19 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818186893 | NA | 2.84E-19 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |