\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818178441:

Variant ID: vg0818178441 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 18178441
Reference Allele: AAlternative Allele: G,ACTG,ACCCCGTTCGTCCCTTTCGACTG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.27, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTTTCGGTCTTTTTAGTACTTCGACCTTTTTTAACTGTTACCGGCTTTCGGTCTTTTCTTTAGTGCTGCTAGGGTTTTGCCGTTCGTCCCTTTCGACT[A/G,ACTG,ACCCCGTTCGTCCCTTTCGACTG]
CCCCGTTCGTCTGCGGGTGTGCAACCGATGCGAACTTGATTTCAAGTTTTAGCCCCTCGCACATTTCCTTGGACTTCTCGGAGTCAAACCGCTTGTTATT

Reverse complement sequence

AATAACAAGCGGTTTGACTCCGAGAAGTCCAAGGAAATGTGCGAGGGGCTAAAACTTGAAATCAAGTTCGCATCGGTTGCACACCCGCAGACGAACGGGG[T/C,CAGT,CAGTCGAAAGGGACGAACGGGGT]
AGTCGAAAGGGACGAACGGCAAAACCCTAGCAGCACTAAAGAAAAGACCGAAAGCCGGTAACAGTTAAAAAAGGTCGAAGTACTAAAAAGACCGAAAGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.90% 44.30% 1.76% 5.44% ACTG: 3.55%; ACCCCGTTCGTCCCTTTCGACTG: 0.02%
All Indica  2759 56.50% 33.10% 2.39% 7.94% ACTG: 0.11%
All Japonica  1512 12.20% 73.60% 1.06% 2.51% ACTG: 10.52%; ACCCCGTTCGTCCCTTTCGACTG: 0.07%
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 44.50% 31.80% 4.37% 19.33% NA
Indica II  465 14.20% 84.30% 0.43% 1.08% NA
Indica III  913 82.60% 9.20% 2.41% 5.81% NA
Indica Intermediate  786 60.30% 31.40% 2.04% 5.85% ACTG: 0.38%
Temperate Japonica  767 12.80% 86.60% 0.13% 0.00% ACTG: 0.52%
Tropical Japonica  504 6.30% 58.30% 1.98% 4.76% ACTG: 28.37%; ACCCCGTTCGTCCCTTTCGACTG: 0.20%
Japonica Intermediate  241 22.80% 64.30% 2.07% 5.81% ACTG: 4.98%
VI/Aromatic  96 93.80% 2.10% 0.00% 0.00% ACTG: 4.17%
Intermediate  90 50.00% 46.70% 1.11% 0.00% ACTG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818178441 A -> G LOC_Os08g29630.1 downstream_gene_variant ; 2193.0bp to feature; MODIFIER silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0818178441 A -> G LOC_Os08g29615-LOC_Os08g29630 intergenic_region ; MODIFIER silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0818178441 A -> ACTG LOC_Os08g29630.1 downstream_gene_variant ; 2192.0bp to feature; MODIFIER silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0818178441 A -> ACTG LOC_Os08g29615-LOC_Os08g29630 intergenic_region ; MODIFIER silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0818178441 A -> DEL N N silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0818178441 A -> ACCCCGTTCGTCCCTTTCGACTG LOC_Os08g29630.1 downstream_gene_variant ; 2192.0bp to feature; MODIFIER silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N
vg0818178441 A -> ACCCCGTTCGTCCCTTTCGACTG LOC_Os08g29615-LOC_Os08g29630 intergenic_region ; MODIFIER silent_mutation Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818178441 NA 7.70E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.97E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.17E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 5.01E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 3.55E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.65E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 9.84E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.32E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 6.42E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.46E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.19E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 5.10E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.91E-07 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 2.36E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.36E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 5.13E-13 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 2.56E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 6.46E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 7.95E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818178441 NA 1.11E-06 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251