\
| Variant ID: vg0818178441 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 18178441 |
| Reference Allele: A | Alternative Allele: G,ACTG,ACCCCGTTCGTCCCTTTCGACTG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.27, others allele: 0.00, population size: 86. )
GGCTTTCGGTCTTTTTAGTACTTCGACCTTTTTTAACTGTTACCGGCTTTCGGTCTTTTCTTTAGTGCTGCTAGGGTTTTGCCGTTCGTCCCTTTCGACT[A/G,ACTG,ACCCCGTTCGTCCCTTTCGACTG]
CCCCGTTCGTCTGCGGGTGTGCAACCGATGCGAACTTGATTTCAAGTTTTAGCCCCTCGCACATTTCCTTGGACTTCTCGGAGTCAAACCGCTTGTTATT
AATAACAAGCGGTTTGACTCCGAGAAGTCCAAGGAAATGTGCGAGGGGCTAAAACTTGAAATCAAGTTCGCATCGGTTGCACACCCGCAGACGAACGGGG[T/C,CAGT,CAGTCGAAAGGGACGAACGGGGT]
AGTCGAAAGGGACGAACGGCAAAACCCTAGCAGCACTAAAGAAAAGACCGAAAGCCGGTAACAGTTAAAAAAGGTCGAAGTACTAAAAAGACCGAAAGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.90% | 44.30% | 1.76% | 5.44% | ACTG: 3.55%; ACCCCGTTCGTCCCTTTCGACTG: 0.02% |
| All Indica | 2759 | 56.50% | 33.10% | 2.39% | 7.94% | ACTG: 0.11% |
| All Japonica | 1512 | 12.20% | 73.60% | 1.06% | 2.51% | ACTG: 10.52%; ACCCCGTTCGTCCCTTTCGACTG: 0.07% |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.50% | 31.80% | 4.37% | 19.33% | NA |
| Indica II | 465 | 14.20% | 84.30% | 0.43% | 1.08% | NA |
| Indica III | 913 | 82.60% | 9.20% | 2.41% | 5.81% | NA |
| Indica Intermediate | 786 | 60.30% | 31.40% | 2.04% | 5.85% | ACTG: 0.38% |
| Temperate Japonica | 767 | 12.80% | 86.60% | 0.13% | 0.00% | ACTG: 0.52% |
| Tropical Japonica | 504 | 6.30% | 58.30% | 1.98% | 4.76% | ACTG: 28.37%; ACCCCGTTCGTCCCTTTCGACTG: 0.20% |
| Japonica Intermediate | 241 | 22.80% | 64.30% | 2.07% | 5.81% | ACTG: 4.98% |
| VI/Aromatic | 96 | 93.80% | 2.10% | 0.00% | 0.00% | ACTG: 4.17% |
| Intermediate | 90 | 50.00% | 46.70% | 1.11% | 0.00% | ACTG: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818178441 | A -> G | LOC_Os08g29630.1 | downstream_gene_variant ; 2193.0bp to feature; MODIFIER | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0818178441 | A -> G | LOC_Os08g29615-LOC_Os08g29630 | intergenic_region ; MODIFIER | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0818178441 | A -> ACTG | LOC_Os08g29630.1 | downstream_gene_variant ; 2192.0bp to feature; MODIFIER | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0818178441 | A -> ACTG | LOC_Os08g29615-LOC_Os08g29630 | intergenic_region ; MODIFIER | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0818178441 | A -> DEL | N | N | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0818178441 | A -> ACCCCGTTCGTCCCTTTCGACTG | LOC_Os08g29630.1 | downstream_gene_variant ; 2192.0bp to feature; MODIFIER | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0818178441 | A -> ACCCCGTTCGTCCCTTTCGACTG | LOC_Os08g29615-LOC_Os08g29630 | intergenic_region ; MODIFIER | silent_mutation | Average:47.903; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818178441 | NA | 7.70E-10 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.97E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.17E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 5.01E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 3.55E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.65E-08 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 9.84E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.32E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 6.42E-07 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.46E-08 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.19E-10 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 5.10E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.91E-07 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 2.36E-10 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.36E-06 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 5.13E-13 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 2.56E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 6.46E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 7.95E-06 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818178441 | NA | 1.11E-06 | mr1996_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |