\
| Variant ID: vg0818156224 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18156224 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTATTTTAGCAAGCTTCAAAATGATTTTTCTCTTAAATTATTTATCCAATCCATGATCCGATCACACTATTGTATTCGTTTTAATTAAATCTTTACAA[C/T]
AAGATATCGCATGATTATATTTTGTTAAAAGAAAAACACATGTTTCAATCCGTTAATACTTATTGTTTCATAAGTGACAACGACATGTTTCAATGTGTAT
ATACACATTGAAACATGTCGTTGTCACTTATGAAACAATAAGTATTAACGGATTGAAACATGTGTTTTTCTTTTAACAAAATATAATCATGCGATATCTT[G/A]
TTGTAAAGATTTAATTAAAACGAATACAATAGTGTGATCGGATCATGGATTGGATAAATAATTTAAGAGAAAAATCATTTTGAAGCTTGCTAAAATACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 4.50% | 2.50% | 0.11% | NA |
| All Indica | 2759 | 96.70% | 1.90% | 1.27% | 0.07% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 12.60% | 56.50% | 29.74% | 1.12% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 1.10% | 1.72% | 0.00% | NA |
| Indica III | 913 | 97.50% | 1.50% | 0.88% | 0.11% | NA |
| Indica Intermediate | 786 | 93.10% | 4.30% | 2.42% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818156224 | C -> T | LOC_Os08g29590.1 | upstream_gene_variant ; 483.0bp to feature; MODIFIER | silent_mutation | Average:64.337; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 | N | N | N | N |
| vg0818156224 | C -> T | LOC_Os08g29600.1 | downstream_gene_variant ; 4834.0bp to feature; MODIFIER | silent_mutation | Average:64.337; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 | N | N | N | N |
| vg0818156224 | C -> T | LOC_Os08g29580-LOC_Os08g29590 | intergenic_region ; MODIFIER | silent_mutation | Average:64.337; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 | N | N | N | N |
| vg0818156224 | C -> DEL | N | N | silent_mutation | Average:64.337; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818156224 | NA | 2.18E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.24E-23 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.51E-32 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.64E-28 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.06E-28 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | 8.07E-07 | 2.24E-21 | mr1113 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.30E-21 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 6.94E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.98E-24 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.81E-20 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.39E-23 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 6.24E-29 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.96E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 7.13E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 5.33E-21 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.81E-21 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.89E-25 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 7.71E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.77E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 7.08E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.68E-17 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 7.90E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.62E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 9.84E-23 | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.43E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.53E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.76E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.64E-20 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 4.55E-28 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 4.20E-28 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.15E-26 | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 4.13E-17 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.39E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 7.68E-20 | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 8.74E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.05E-18 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 9.40E-20 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 9.55E-33 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 4.03E-25 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.97E-20 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.45E-19 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.33E-22 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 5.91E-19 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.72E-26 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 3.88E-25 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 5.77E-20 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 7.93E-26 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.31E-10 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.69E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 1.35E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 4.06E-21 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.74E-15 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818156224 | NA | 2.30E-16 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |