\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818069929:

Variant ID: vg0818069929 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18069929
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCAACGACCCCATGCGCACGCATGTGGGCGAGCGCTGGGACTGAGGTGAGGAGGACGCGAAGAGGGTGATTCGGCGGGTGCTGGGCCTAGACTCCGCC[G/A,T]
AGCCAACACTAATCCCAGATGGGATTCTTCCCCTCTGCTGCGACCGCGACCGGGAGAGCATCCTAGCCATGATGTCAGCTGTCGGTGCCAGCTGGAGTCG

Reverse complement sequence

CGACTCCAGCTGGCACCGACAGCTGACATCATGGCTAGGATGCTCTCCCGGTCGCGGTCGCAGCAGAGGGGAAGAATCCCATCTGGGATTAGTGTTGGCT[C/T,A]
GGCGGAGTCTAGGCCCAGCACCCGCCGAATCACCCTCTTCGCGTCCTCCTCACCTCAGTCCCAGCGCTCGCCCACATGCGTGCGCATGGGGTCGTTGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 5.00% 3.32% 16.95% T: 0.02%
All Indica  2759 77.70% 0.30% 3.08% 18.88% T: 0.04%
All Japonica  1512 78.60% 8.90% 2.84% 9.66% NA
Aus  269 44.20% 0.00% 10.41% 45.35% NA
Indica I  595 70.90% 0.00% 4.37% 24.54% T: 0.17%
Indica II  465 92.70% 0.00% 2.37% 4.95% NA
Indica III  913 78.40% 0.50% 2.08% 18.95% NA
Indica Intermediate  786 73.20% 0.40% 3.69% 22.77% NA
Temperate Japonica  767 86.70% 11.10% 0.39% 1.83% NA
Tropical Japonica  504 73.20% 0.80% 5.56% 20.44% NA
Japonica Intermediate  241 63.90% 19.10% 4.98% 12.03% NA
VI/Aromatic  96 13.50% 83.30% 0.00% 3.12% NA
Intermediate  90 76.70% 12.20% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818069929 G -> T LOC_Os08g29480.1 stop_gained ; p.Glu251*; HIGH stop_gained Average:81.31; most accessible tissue: Zhenshan97 flag leaf, score: 91.729 N N N N
vg0818069929 G -> A LOC_Os08g29480.1 missense_variant ; p.Glu251Lys; MODERATE nonsynonymous_codon ; E251K Average:81.31; most accessible tissue: Zhenshan97 flag leaf, score: 91.729 benign 0.334 TOLERATED 0.07
vg0818069929 G -> DEL LOC_Os08g29480.1 N frameshift_variant Average:81.31; most accessible tissue: Zhenshan97 flag leaf, score: 91.729 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818069929 G A 0.0 0.0 0.0 0.0 0.0 0.0
vg0818069929 G T 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818069929 NA 3.61E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818069929 NA 9.02E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818069929 2.88E-06 2.88E-06 mr1986 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818069929 2.07E-08 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251