\
| Variant ID: vg0818058241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18058241 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATCCCGTATGCTATTTACGAACTAACCAAGA[T/G]
ATAATTCTCACAAGATAAATCCAAATTACTCAAGAAGAATATTATATTGAATTCAGAGTAATAAACAGAATAAAAGAAATAGGAGAAGATCACCGACAAC
GTTGTCGGTGATCTTCTCCTATTTCTTTTATTCTGTTTATTACTCTGAATTCAATATAATATTCTTCTTGAGTAATTTGGATTTATCTTGTGAGAATTAT[A/C]
TCTTGGTTAGTTCGTAAATAGCATACGGGATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.10% | 22.40% | 3.53% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 2.70% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 28.00% | 62.00% | 9.92% | 0.00% | NA |
| Aus | 269 | 90.70% | 8.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 1.20% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 14.20% | 85.00% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 45.80% | 31.90% | 22.22% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.90% | 51.90% | 13.28% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 23.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818058241 | T -> G | LOC_Os08g29450.1 | upstream_gene_variant ; 3265.0bp to feature; MODIFIER | silent_mutation | Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0818058241 | T -> G | LOC_Os08g29460.1 | downstream_gene_variant ; 333.0bp to feature; MODIFIER | silent_mutation | Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0818058241 | T -> G | LOC_Os08g29470.1 | downstream_gene_variant ; 3761.0bp to feature; MODIFIER | silent_mutation | Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0818058241 | T -> G | LOC_Os08g29460-LOC_Os08g29470 | intergenic_region ; MODIFIER | silent_mutation | Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818058241 | NA | 3.19E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818058241 | NA | 1.41E-09 | mr1368 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818058241 | NA | 2.08E-06 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818058241 | NA | 1.49E-07 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818058241 | NA | 5.27E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818058241 | NA | 4.20E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |