\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818058241:

Variant ID: vg0818058241 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18058241
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATCCCGTATGCTATTTACGAACTAACCAAGA[T/G]
ATAATTCTCACAAGATAAATCCAAATTACTCAAGAAGAATATTATATTGAATTCAGAGTAATAAACAGAATAAAAGAAATAGGAGAAGATCACCGACAAC

Reverse complement sequence

GTTGTCGGTGATCTTCTCCTATTTCTTTTATTCTGTTTATTACTCTGAATTCAATATAATATTCTTCTTGAGTAATTTGGATTTATCTTGTGAGAATTAT[A/C]
TCTTGGTTAGTTCGTAAATAGCATACGGGATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 22.40% 3.53% 0.00% NA
All Indica  2759 96.90% 2.70% 0.43% 0.00% NA
All Japonica  1512 28.00% 62.00% 9.92% 0.00% NA
Aus  269 90.70% 8.90% 0.37% 0.00% NA
Indica I  595 92.90% 7.10% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.00% 1.20% 0.77% 0.00% NA
Indica Intermediate  786 96.90% 2.40% 0.64% 0.00% NA
Temperate Japonica  767 14.20% 85.00% 0.78% 0.00% NA
Tropical Japonica  504 45.80% 31.90% 22.22% 0.00% NA
Japonica Intermediate  241 34.90% 51.90% 13.28% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 23.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818058241 T -> G LOC_Os08g29450.1 upstream_gene_variant ; 3265.0bp to feature; MODIFIER silent_mutation Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0818058241 T -> G LOC_Os08g29460.1 downstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0818058241 T -> G LOC_Os08g29470.1 downstream_gene_variant ; 3761.0bp to feature; MODIFIER silent_mutation Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0818058241 T -> G LOC_Os08g29460-LOC_Os08g29470 intergenic_region ; MODIFIER silent_mutation Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818058241 NA 3.19E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241 NA 1.41E-09 mr1368 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241 NA 2.08E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241 NA 1.49E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241 NA 5.27E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241 NA 4.20E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251