Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0818058241:

Variant ID: vg0818058241 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18058241
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATCCCGTATGCTATTTACGAACTAACCAAGA[T/G]
ATAATTCTCACAAGATAAATCCAAATTACTCAAGAAGAATATTATATTGAATTCAGAGTAATAAACAGAATAAAAGAAATAGGAGAAGATCACCGACAAC

Reverse complement sequence

GTTGTCGGTGATCTTCTCCTATTTCTTTTATTCTGTTTATTACTCTGAATTCAATATAATATTCTTCTTGAGTAATTTGGATTTATCTTGTGAGAATTAT[A/C]
TCTTGGTTAGTTCGTAAATAGCATACGGGATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.10%	22.40%	3.53%	0.00%	NA
All Indica	2759	96.90%	2.70%	0.43%	0.00%	NA
All Japonica	1512	28.00%	62.00%	9.92%	0.00%	NA
Aus	269	90.70%	8.90%	0.37%	0.00%	NA
Indica I	595	92.90%	7.10%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.00%	1.20%	0.77%	0.00%	NA
Indica Intermediate	786	96.90%	2.40%	0.64%	0.00%	NA
Temperate Japonica	767	14.20%	85.00%	0.78%	0.00%	NA
Tropical Japonica	504	45.80%	31.90%	22.22%	0.00%	NA
Japonica Intermediate	241	34.90%	51.90%	13.28%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	23.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818058241	T -> G	LOC_Os08g29450.1	upstream_gene_variant ; 3265.0bp to feature; MODIFIER	silent_mutation	Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0818058241	T -> G	LOC_Os08g29460.1	downstream_gene_variant ; 333.0bp to feature; MODIFIER	silent_mutation	Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0818058241	T -> G	LOC_Os08g29470.1	downstream_gene_variant ; 3761.0bp to feature; MODIFIER	silent_mutation	Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0818058241	T -> G	LOC_Os08g29460-LOC_Os08g29470	intergenic_region ; MODIFIER	silent_mutation	Average:48.551; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818058241	NA	3.19E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241	NA	1.41E-09	mr1368	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241	NA	2.08E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241	NA	1.49E-07	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241	NA	5.27E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818058241	NA	4.20E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251