\
| Variant ID: vg0818053416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18053416 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTATTATTTAATGATGGCTTAATGTTAGCTCACGATGGTCAATCGTGATTGGTTAATTAATTAAATTGCCAACTAAAACCTGATAATGGTGGGTTGTGAG[C/T]
ACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACGGGTTCACGATTTTCGGTTGTGAAACATTTACCGTGCCAACCACAAGCCAGCGTGGGCAACG
CGTTGCCCACGCTGGCTTGTGGTTGGCACGGTAAATGTTTCACAACCGAAAATCGTGAACCCGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGT[G/A]
CTCACAACCCACCATTATCAGGTTTTAGTTGGCAATTTAATTAATTAACCAATCACGATTGACCATCGTGAGCTAACATTAAGCCATCATTAAATAATAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 4.10% | 1.57% | 5.44% | NA |
| All Indica | 2759 | 90.90% | 0.40% | 0.72% | 7.97% | NA |
| All Japonica | 1512 | 83.60% | 11.40% | 3.04% | 1.98% | NA |
| Aus | 269 | 94.10% | 1.90% | 2.97% | 1.12% | NA |
| Indica I | 595 | 93.90% | 0.00% | 2.02% | 4.03% | NA |
| Indica II | 465 | 98.50% | 0.20% | 0.43% | 0.86% | NA |
| Indica III | 913 | 87.60% | 0.80% | 0.33% | 11.28% | NA |
| Indica Intermediate | 786 | 87.90% | 0.40% | 0.38% | 11.32% | NA |
| Temperate Japonica | 767 | 98.00% | 1.00% | 0.65% | 0.26% | NA |
| Tropical Japonica | 504 | 62.90% | 25.40% | 6.35% | 5.36% | NA |
| Japonica Intermediate | 241 | 80.90% | 14.90% | 3.73% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818053416 | C -> T | LOC_Os08g29460.1 | upstream_gene_variant ; 3469.0bp to feature; MODIFIER | silent_mutation | Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| vg0818053416 | C -> T | LOC_Os08g29440.1 | downstream_gene_variant ; 3437.0bp to feature; MODIFIER | silent_mutation | Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| vg0818053416 | C -> T | LOC_Os08g29450.1 | downstream_gene_variant ; 1117.0bp to feature; MODIFIER | silent_mutation | Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| vg0818053416 | C -> T | LOC_Os08g29440-LOC_Os08g29450 | intergenic_region ; MODIFIER | silent_mutation | Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| vg0818053416 | C -> DEL | N | N | silent_mutation | Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818053416 | NA | 5.23E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818053416 | NA | 3.72E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818053416 | NA | 7.47E-06 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818053416 | NA | 8.47E-08 | mr1277_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818053416 | NA | 1.99E-06 | mr1362_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818053416 | NA | 2.05E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |