\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818053416:

Variant ID: vg0818053416 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18053416
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATTATTTAATGATGGCTTAATGTTAGCTCACGATGGTCAATCGTGATTGGTTAATTAATTAAATTGCCAACTAAAACCTGATAATGGTGGGTTGTGAG[C/T]
ACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACGGGTTCACGATTTTCGGTTGTGAAACATTTACCGTGCCAACCACAAGCCAGCGTGGGCAACG

Reverse complement sequence

CGTTGCCCACGCTGGCTTGTGGTTGGCACGGTAAATGTTTCACAACCGAAAATCGTGAACCCGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGT[G/A]
CTCACAACCCACCATTATCAGGTTTTAGTTGGCAATTTAATTAATTAACCAATCACGATTGACCATCGTGAGCTAACATTAAGCCATCATTAAATAATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 4.10% 1.57% 5.44% NA
All Indica  2759 90.90% 0.40% 0.72% 7.97% NA
All Japonica  1512 83.60% 11.40% 3.04% 1.98% NA
Aus  269 94.10% 1.90% 2.97% 1.12% NA
Indica I  595 93.90% 0.00% 2.02% 4.03% NA
Indica II  465 98.50% 0.20% 0.43% 0.86% NA
Indica III  913 87.60% 0.80% 0.33% 11.28% NA
Indica Intermediate  786 87.90% 0.40% 0.38% 11.32% NA
Temperate Japonica  767 98.00% 1.00% 0.65% 0.26% NA
Tropical Japonica  504 62.90% 25.40% 6.35% 5.36% NA
Japonica Intermediate  241 80.90% 14.90% 3.73% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 92.20% 4.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818053416 C -> T LOC_Os08g29460.1 upstream_gene_variant ; 3469.0bp to feature; MODIFIER silent_mutation Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0818053416 C -> T LOC_Os08g29440.1 downstream_gene_variant ; 3437.0bp to feature; MODIFIER silent_mutation Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0818053416 C -> T LOC_Os08g29450.1 downstream_gene_variant ; 1117.0bp to feature; MODIFIER silent_mutation Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0818053416 C -> T LOC_Os08g29440-LOC_Os08g29450 intergenic_region ; MODIFIER silent_mutation Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0818053416 C -> DEL N N silent_mutation Average:52.009; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818053416 NA 5.23E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416 NA 3.72E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416 NA 7.47E-06 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416 NA 8.47E-08 mr1277_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416 NA 1.99E-06 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818053416 NA 2.05E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251