\
| Variant ID: vg0818051811 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 18051811 |
| Reference Allele: G | Alternative Allele: GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC,A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACTATAAACATCCATTTCACAGTGGTACACCTCTGGCTAGAGTAAAACTATTCGAATAGCCGTGCCCGCGGTTATGGGTGGGTCTAACAATGTCTTTC[G/GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC,A,C]
TGATTAGTCTCACACTTCTCACCATAATAAAAGATGCTATAACTGGTAATAATTTGATTAGCTCCTGGTTTGGAATGGTACATTCCTGGTTTGAAGATAG
CTATCTTCAAACCAGGAATGTACCATTCCAAACCAGGAGCTAATCAAATTATTACCAGTTATAGCATCTTTTATTATGGTGAGAAGTGTGAGACTAATCA[C/GCAATGATGTCATCACCGGCTGCGGCTCGGCAACGCAC,T,G]
GAAAGACATTGTTAGACCCACCCATAACCGCGGGCACGGCTATTCGAATAGTTTTACTCTAGCCAGAGGTGTACCACTGTGAAATGGATGTTTATAGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 4.20% | 8.95% | 11.89% | GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC: 0.23%; C: 0.15% |
| All Indica | 2759 | 74.70% | 0.20% | 13.52% | 10.91% | GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC: 0.40%; C: 0.25% |
| All Japonica | 1512 | 73.10% | 12.00% | 1.59% | 13.36% | NA |
| Aus | 269 | 78.80% | 1.90% | 5.58% | 13.75% | NA |
| Indica I | 595 | 71.60% | 0.00% | 20.17% | 8.07% | GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC: 0.17% |
| Indica II | 465 | 62.60% | 0.20% | 20.22% | 15.48% | C: 0.86%; GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC: 0.65% |
| Indica III | 913 | 83.40% | 0.40% | 5.37% | 10.19% | GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC: 0.55%; C: 0.11% |
| Indica Intermediate | 786 | 74.20% | 0.10% | 13.99% | 11.20% | C: 0.25%; GTGCGTTGCCGAGCCGCAGCCGGTGATGACATCATTGC: 0.25% |
| Temperate Japonica | 767 | 97.10% | 1.00% | 0.26% | 1.56% | NA |
| Tropical Japonica | 504 | 36.30% | 26.40% | 3.37% | 33.93% | NA |
| Japonica Intermediate | 241 | 73.40% | 16.60% | 2.07% | 7.88% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 68.90% | 5.60% | 12.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818051811 | G -> C | LOC_Os08g29440.1 | downstream_gene_variant ; 1832.0bp to feature; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> C | LOC_Os08g29450.1 | downstream_gene_variant ; 2722.0bp to feature; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> C | LOC_Os08g29440-LOC_Os08g29450 | intergenic_region ; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> A | LOC_Os08g29440.1 | downstream_gene_variant ; 1832.0bp to feature; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> A | LOC_Os08g29450.1 | downstream_gene_variant ; 2722.0bp to feature; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> A | LOC_Os08g29440-LOC_Os08g29450 | intergenic_region ; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> DEL | N | N | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> GTGCGTTGCCGAGCCGCAGCCGGTGATGAC ATCATTGC | LOC_Os08g29440.1 | downstream_gene_variant ; 1833.0bp to feature; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> GTGCGTTGCCGAGCCGCAGCCGGTGATGAC ATCATTGC | LOC_Os08g29450.1 | downstream_gene_variant ; 2721.0bp to feature; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg0818051811 | G -> GTGCGTTGCCGAGCCGCAGCCGGTGATGAC ATCATTGC | LOC_Os08g29440-LOC_Os08g29450 | intergenic_region ; MODIFIER | silent_mutation | Average:44.387; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818051811 | NA | 1.25E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | 7.26E-07 | 2.64E-21 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | 2.08E-08 | 3.70E-19 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 6.15E-13 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | 4.44E-07 | NA | mr1533 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 1.50E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 1.31E-06 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | 4.26E-06 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 3.45E-11 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 1.21E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | 7.12E-06 | NA | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 4.71E-07 | mr1362_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | 4.44E-06 | 2.47E-16 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 2.09E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 3.34E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 1.09E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818051811 | NA | 5.73E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |