\
| Variant ID: vg0818047553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18047553 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCACTTAGTCCTCACCATGAAGAAAACTGCAGCGGAAAAATAAAACCTAGCGAGCTTCAGCTCCACTCCCACAGGCAGCTCAACTGGGGTATAAGCCAAA[G/C]
GTCTTCTCCTTCAGAATCCTTTTTCTTCAACTGAGGTTTGATGATTATTGCAAGGTGAGCATATGACATACTCAGCAAGCCACATAGCATATATGCAAGT
ACTTGCATATATGCTATGTGGCTTGCTGAGTATGTCATATGCTCACCTTGCAATAATCATCAAACCTCAGTTGAAGAAAAAGGATTCTGAAGGAGAAGAC[C/G]
TTTGGCTTATACCCCAGTTGAGCTGCCTGTGGGAGTGGAGCTGAAGCTCGCTAGGTTTTATTTTTCCGCTGCAGTTTTCTTCATGGTGAGGACTAAGTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 22.10% | 0.89% | 25.54% | NA |
| All Indica | 2759 | 70.20% | 2.90% | 1.27% | 25.63% | NA |
| All Japonica | 1512 | 23.30% | 61.80% | 0.40% | 14.48% | NA |
| Aus | 269 | 4.10% | 2.60% | 0.37% | 92.94% | NA |
| Indica I | 595 | 58.80% | 7.70% | 1.85% | 31.60% | NA |
| Indica II | 465 | 91.00% | 0.60% | 0.65% | 7.74% | NA |
| Indica III | 913 | 72.40% | 0.90% | 1.31% | 25.41% | NA |
| Indica Intermediate | 786 | 63.90% | 3.10% | 1.15% | 31.93% | NA |
| Temperate Japonica | 767 | 13.20% | 85.30% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 31.30% | 31.00% | 0.99% | 36.71% | NA |
| Japonica Intermediate | 241 | 39.00% | 51.50% | 0.41% | 9.13% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 54.40% | 24.40% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818047553 | G -> C | LOC_Os08g29430.1 | upstream_gene_variant ; 1209.0bp to feature; MODIFIER | silent_mutation | Average:39.0; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg0818047553 | G -> C | LOC_Os08g29440.1 | upstream_gene_variant ; 1599.0bp to feature; MODIFIER | silent_mutation | Average:39.0; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg0818047553 | G -> C | LOC_Os08g29430-LOC_Os08g29440 | intergenic_region ; MODIFIER | silent_mutation | Average:39.0; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg0818047553 | G -> DEL | N | N | silent_mutation | Average:39.0; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818047553 | 4.30E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | NA | 2.98E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | NA | 9.05E-06 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | NA | 2.49E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | NA | 1.73E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | NA | 1.26E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | NA | 1.33E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818047553 | 3.07E-06 | 3.07E-06 | mr1474_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |