Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818041875:

Variant ID: vg0818041875 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18041875
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCTTGGGATATAACATGACTAGAGATTGGACTAGAGATTGCTTAGCCATGCTTAGTTCAACTAGCACACAATAAGGGAGATCCTATTAATTGTTTAGA[C/T]
TGTAGGTTCTAATGGTATTGTTGGATTAGTGACACCGCTTCGGTGTTGGTTAATTAAAATAAATCACATGGTGGGCTGTGGGTGCATGGTTTTGCTGGTC

Reverse complement sequence

GACCAGCAAAACCATGCACCCACAGCCCACCATGTGATTTATTTTAATTAACCAACACCGAAGCGGTGTCACTAATCCAACAATACCATTAGAACCTACA[G/A]
TCTAAACAATTAATAGGATCTCCCTTATTGTGTGCTAGTTGAACTAAGCATGGCTAAGCAATCTCTAGTCCAATCTCTAGTCATGTTATATCCCAAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	4.40%	0.91%	5.80%	NA
All Indica	2759	97.20%	0.40%	0.76%	1.63%	NA
All Japonica	1512	72.90%	12.50%	0.33%	14.22%	NA
Aus	269	92.60%	1.10%	5.58%	0.74%	NA
Indica I	595	96.30%	0.00%	2.69%	1.01%	NA
Indica II	465	99.10%	0.20%	0.00%	0.65%	NA
Indica III	913	97.50%	0.80%	0.00%	1.75%	NA
Indica Intermediate	786	96.40%	0.40%	0.64%	2.54%	NA
Temperate Japonica	767	97.40%	1.00%	0.00%	1.56%	NA
Tropical Japonica	504	35.50%	27.60%	0.99%	35.91%	NA
Japonica Intermediate	241	73.40%	17.40%	0.00%	9.13%	NA
VI/Aromatic	96	90.60%	0.00%	1.04%	8.33%	NA
Intermediate	90	90.00%	4.40%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818041875	C -> T	LOC_Os08g29420.1	upstream_gene_variant ; 2286.0bp to feature; MODIFIER	silent_mutation	Average:40.545; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0818041875	C -> T	LOC_Os08g29430.1	downstream_gene_variant ; 1069.0bp to feature; MODIFIER	silent_mutation	Average:40.545; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0818041875	C -> T	LOC_Os08g29420-LOC_Os08g29430	intergenic_region ; MODIFIER	silent_mutation	Average:40.545; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0818041875	C -> DEL	N	N	silent_mutation	Average:40.545; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818041875	NA	4.34E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	7.19E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.31E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.10E-10	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	4.25E-06	1.52E-07	mr1836	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.76E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.40E-11	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.32E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.19E-06	mr1362_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	2.59E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	3.44E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818041875	NA	4.64E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251