\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818001372:

Variant ID: vg0818001372 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18001372
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTATTTTTAACTAAACAATCACTAACCACCATAGACGCCACATCAACCAAAACCACCATGCAAATTAACCACCGTGGGATCATGCATATTTGCACCG[G/T,A]
TTTTGAGAGTTGAGGGACATATCATAGTATTGTGGTATTGTGATTTAGGGACGGATTTCAGACTCGGTGATAAATTGAGAGACCTAAAGTGAACTTATTG

Reverse complement sequence

CAATAAGTTCACTTTAGGTCTCTCAATTTATCACCGAGTCTGAAATCCGTCCCTAAATCACAATACCACAATACTATGATATGTCCCTCAACTCTCAAAA[C/A,T]
CGGTGCAAATATGCATGATCCCACGGTGGTTAATTTGCATGGTGGTTTTGGTTGATGTGGCGTCTATGGTGGTTAGTGATTGTTTAGTTAAAAATAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 9.90% 4.91% 0.00% A: 0.40%
All Indica  2759 75.20% 16.10% 8.12% 0.00% A: 0.65%
All Japonica  1512 98.90% 0.90% 0.26% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% A: 0.37%
Indica I  595 76.30% 5.90% 17.82% 0.00% NA
Indica II  465 23.00% 59.60% 15.27% 0.00% A: 2.15%
Indica III  913 99.80% 0.10% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 76.60% 16.50% 5.98% 0.00% A: 0.89%
Temperate Japonica  767 98.70% 0.90% 0.39% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818001372 G -> T LOC_Os08g29340.1 upstream_gene_variant ; 3753.0bp to feature; MODIFIER silent_mutation Average:95.912; most accessible tissue: Minghui63 young leaf, score: 97.747 N N N N
vg0818001372 G -> T LOC_Os08g29350.1 downstream_gene_variant ; 1186.0bp to feature; MODIFIER silent_mutation Average:95.912; most accessible tissue: Minghui63 young leaf, score: 97.747 N N N N
vg0818001372 G -> T LOC_Os08g29350-LOC_Os08g29360 intergenic_region ; MODIFIER silent_mutation Average:95.912; most accessible tissue: Minghui63 young leaf, score: 97.747 N N N N
vg0818001372 G -> A LOC_Os08g29340.1 upstream_gene_variant ; 3753.0bp to feature; MODIFIER silent_mutation Average:95.912; most accessible tissue: Minghui63 young leaf, score: 97.747 N N N N
vg0818001372 G -> A LOC_Os08g29350.1 downstream_gene_variant ; 1186.0bp to feature; MODIFIER silent_mutation Average:95.912; most accessible tissue: Minghui63 young leaf, score: 97.747 N N N N
vg0818001372 G -> A LOC_Os08g29350-LOC_Os08g29360 intergenic_region ; MODIFIER silent_mutation Average:95.912; most accessible tissue: Minghui63 young leaf, score: 97.747 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818001372 G A -0.01 -0.01 -0.01 -0.01 -0.01 0.0
vg0818001372 G T -0.02 -0.02 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818001372 NA 3.31E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 7.65E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 2.22E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 1.98E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 4.64E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 1.82E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 1.64E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 1.33E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 8.29E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 4.23E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 6.88E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 4.10E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 4.02E-09 mr1539_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 3.53E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 1.17E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 4.15E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 5.67E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 3.96E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818001372 NA 3.15E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251