Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817943383:

Variant ID: vg0817943383 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17943383
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGACTAGCTCATCTGGAATTTTGTCATCTATTTCATGGAGCCTATCTCTAATAGGGACCACCTGCGATTATTCCAGGCGGTCTATTTATGTGGTCCGCCT[A/G]
TGAAGCTCCATCTTCGCAGGCGCCCATTTTTTGCCACCTGCAAAATTCATTCACGGCAACACCATTTACCGCCTATAAAAATCTGGCCGACTATATAGTC

Reverse complement sequence

GACTATATAGTCGGCCAGATTTTTATAGGCGGTAAATGGTGTTGCCGTGAATGAATTTTGCAGGTGGCAAAAAATGGGCGCCTGCGAAGATGGAGCTTCA[T/C]
AGGCGGACCACATAAATAGACCGCCTGGAATAATCGCAGGTGGTCCCTATTAGAGATAGGCTCCATGAAATAGATGACAAAATTCCAGATGAGCTAGTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	18.70%	0.30%	7.51%	NA
All Indica	2759	85.60%	1.30%	0.51%	12.58%	NA
All Japonica	1512	44.60%	55.00%	0.00%	0.33%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	90.60%	2.90%	0.34%	6.22%	NA
Indica II	465	98.10%	0.60%	0.22%	1.08%	NA
Indica III	913	80.80%	0.50%	0.88%	17.74%	NA
Indica Intermediate	786	79.90%	1.50%	0.38%	18.19%	NA
Temperate Japonica	767	15.60%	84.10%	0.00%	0.26%	NA
Tropical Japonica	504	78.20%	21.20%	0.00%	0.60%	NA
Japonica Intermediate	241	66.80%	33.20%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	82.20%	16.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817943383	A -> G	LOC_Os08g29250.1	upstream_gene_variant ; 4721.0bp to feature; MODIFIER	silent_mutation	Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0817943383	A -> G	LOC_Os08g29280.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0817943383	A -> G	LOC_Os08g29260.1	downstream_gene_variant ; 1191.0bp to feature; MODIFIER	silent_mutation	Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0817943383	A -> G	LOC_Os08g29270.1	intron_variant ; MODIFIER	silent_mutation	Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0817943383	A -> DEL	N	N	silent_mutation	Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817943383	4.01E-08	NA	mr1080	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	2.93E-06	NA	mr1080	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	5.82E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	1.96E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	3.84E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	4.22E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	6.83E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	3.74E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	5.62E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	NA	5.06E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383	1.55E-06	NA	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251