\
| Variant ID: vg0817943383 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17943383 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGACTAGCTCATCTGGAATTTTGTCATCTATTTCATGGAGCCTATCTCTAATAGGGACCACCTGCGATTATTCCAGGCGGTCTATTTATGTGGTCCGCCT[A/G]
TGAAGCTCCATCTTCGCAGGCGCCCATTTTTTGCCACCTGCAAAATTCATTCACGGCAACACCATTTACCGCCTATAAAAATCTGGCCGACTATATAGTC
GACTATATAGTCGGCCAGATTTTTATAGGCGGTAAATGGTGTTGCCGTGAATGAATTTTGCAGGTGGCAAAAAATGGGCGCCTGCGAAGATGGAGCTTCA[T/C]
AGGCGGACCACATAAATAGACCGCCTGGAATAATCGCAGGTGGTCCCTATTAGAGATAGGCTCCATGAAATAGATGACAAAATTCCAGATGAGCTAGTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 18.70% | 0.30% | 7.51% | NA |
| All Indica | 2759 | 85.60% | 1.30% | 0.51% | 12.58% | NA |
| All Japonica | 1512 | 44.60% | 55.00% | 0.00% | 0.33% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 2.90% | 0.34% | 6.22% | NA |
| Indica II | 465 | 98.10% | 0.60% | 0.22% | 1.08% | NA |
| Indica III | 913 | 80.80% | 0.50% | 0.88% | 17.74% | NA |
| Indica Intermediate | 786 | 79.90% | 1.50% | 0.38% | 18.19% | NA |
| Temperate Japonica | 767 | 15.60% | 84.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 78.20% | 21.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817943383 | A -> G | LOC_Os08g29250.1 | upstream_gene_variant ; 4721.0bp to feature; MODIFIER | silent_mutation | Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0817943383 | A -> G | LOC_Os08g29280.1 | upstream_gene_variant ; 3070.0bp to feature; MODIFIER | silent_mutation | Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0817943383 | A -> G | LOC_Os08g29260.1 | downstream_gene_variant ; 1191.0bp to feature; MODIFIER | silent_mutation | Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0817943383 | A -> G | LOC_Os08g29270.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0817943383 | A -> DEL | N | N | silent_mutation | Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817943383 | 4.01E-08 | NA | mr1080 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | 2.93E-06 | NA | mr1080 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 5.82E-30 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 1.96E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 3.84E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 4.22E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 6.83E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 3.74E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 5.62E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | NA | 5.06E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817943383 | 1.55E-06 | NA | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |