\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817943383:

Variant ID: vg0817943383 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17943383
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACTAGCTCATCTGGAATTTTGTCATCTATTTCATGGAGCCTATCTCTAATAGGGACCACCTGCGATTATTCCAGGCGGTCTATTTATGTGGTCCGCCT[A/G]
TGAAGCTCCATCTTCGCAGGCGCCCATTTTTTGCCACCTGCAAAATTCATTCACGGCAACACCATTTACCGCCTATAAAAATCTGGCCGACTATATAGTC

Reverse complement sequence

GACTATATAGTCGGCCAGATTTTTATAGGCGGTAAATGGTGTTGCCGTGAATGAATTTTGCAGGTGGCAAAAAATGGGCGCCTGCGAAGATGGAGCTTCA[T/C]
AGGCGGACCACATAAATAGACCGCCTGGAATAATCGCAGGTGGTCCCTATTAGAGATAGGCTCCATGAAATAGATGACAAAATTCCAGATGAGCTAGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 18.70% 0.30% 7.51% NA
All Indica  2759 85.60% 1.30% 0.51% 12.58% NA
All Japonica  1512 44.60% 55.00% 0.00% 0.33% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 90.60% 2.90% 0.34% 6.22% NA
Indica II  465 98.10% 0.60% 0.22% 1.08% NA
Indica III  913 80.80% 0.50% 0.88% 17.74% NA
Indica Intermediate  786 79.90% 1.50% 0.38% 18.19% NA
Temperate Japonica  767 15.60% 84.10% 0.00% 0.26% NA
Tropical Japonica  504 78.20% 21.20% 0.00% 0.60% NA
Japonica Intermediate  241 66.80% 33.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817943383 A -> G LOC_Os08g29250.1 upstream_gene_variant ; 4721.0bp to feature; MODIFIER silent_mutation Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0817943383 A -> G LOC_Os08g29280.1 upstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0817943383 A -> G LOC_Os08g29260.1 downstream_gene_variant ; 1191.0bp to feature; MODIFIER silent_mutation Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0817943383 A -> G LOC_Os08g29270.1 intron_variant ; MODIFIER silent_mutation Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0817943383 A -> DEL N N silent_mutation Average:46.721; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817943383 4.01E-08 NA mr1080 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 2.93E-06 NA mr1080 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 5.82E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 1.96E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 3.84E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 4.22E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 6.83E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 3.74E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 5.62E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 NA 5.06E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817943383 1.55E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251