\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817921068:

Variant ID: vg0817921068 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17921068
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTTATATTTAATCCCCTTTAATTAGCTAATGTTTCTAAGCATGGCTAAGCAAACATACATATAACATTTAGCTGAACCAATCCAATATGTAAGGTTC[C/A]
TGCTAATCAAATTATAACCCATAGGAAAATAAGATCATCTTCGGCCATTAATTAATTGGGAAAGGTTCACCACCCGATGACATTCAAAAACAATGCATAG

Reverse complement sequence

CTATGCATTGTTTTTGAATGTCATCGGGTGGTGAACCTTTCCCAATTAATTAATGGCCGAAGATGATCTTATTTTCCTATGGGTTATAATTTGATTAGCA[G/T]
GAACCTTACATATTGGATTGGTTCAGCTAAATGTTATATGTATGTTTGCTTAGCCATGCTTAGAAACATTAGCTAATTAAAGGGGATTAAATATAAATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 19.70% 9.16% 3.34% NA
All Indica  2759 92.70% 2.70% 4.60% 0.00% NA
All Japonica  1512 17.10% 55.30% 17.26% 10.32% NA
Aus  269 97.00% 0.40% 2.60% 0.00% NA
Indica I  595 86.70% 3.70% 9.58% 0.00% NA
Indica II  465 92.50% 2.60% 4.95% 0.00% NA
Indica III  913 96.20% 2.10% 1.75% 0.00% NA
Indica Intermediate  786 93.30% 2.80% 3.94% 0.00% NA
Temperate Japonica  767 2.10% 84.60% 12.39% 0.91% NA
Tropical Japonica  504 38.10% 21.20% 18.65% 22.02% NA
Japonica Intermediate  241 21.20% 33.20% 29.88% 15.77% NA
VI/Aromatic  96 66.70% 3.10% 30.21% 0.00% NA
Intermediate  90 68.90% 18.90% 10.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817921068 C -> A LOC_Os08g29240.1 upstream_gene_variant ; 4834.0bp to feature; MODIFIER silent_mutation Average:54.605; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0817921068 C -> A LOC_Os08g29230.1 intron_variant ; MODIFIER silent_mutation Average:54.605; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0817921068 C -> DEL N N silent_mutation Average:54.605; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817921068 C A -0.02 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817921068 NA 2.16E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817921068 NA 1.82E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817921068 NA 1.30E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817921068 6.88E-07 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817921068 1.86E-08 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251