\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817853841:

Variant ID: vg0817853841 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17853841
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCCTATAACTAATTAGTTCTTGGATGTGCATCAAAAGATTTTAATATTAACAGTGTTTTTGTCTTGTTGATATCCTCTCAGGACTTTAAGCTTACTC[A/G]
TTTTCCGTATATTTTTTAACAGATTACAGAACAAATATTTGTTGGATCATGCCTACAAACAGAAAGAGATGTGAAAATGCTATCAGAGACTATGGTAGGT

Reverse complement sequence

ACCTACCATAGTCTCTGATAGCATTTTCACATCTCTTTCTGTTTGTAGGCATGATCCAACAAATATTTGTTCTGTAATCTGTTAAAAAATATACGGAAAA[T/C]
GAGTAAGCTTAAAGTCCTGAGAGGATATCAACAAGACAAAAACACTGTTAATATTAAAATCTTTTGATGCACATCCAAGAACTAATTAGTTATAGGAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 18.00% 0.00% 0.00% NA
All Indica  2759 86.60% 13.40% 0.00% 0.00% NA
All Japonica  1512 71.70% 28.30% 0.00% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 63.20% 36.80% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.60% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 32.30% 67.70% 0.00% 0.00% NA
Japonica Intermediate  241 72.20% 27.80% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817853841 A -> G LOC_Os08g29150.1 downstream_gene_variant ; 2925.0bp to feature; MODIFIER silent_mutation Average:57.451; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N
vg0817853841 A -> G LOC_Os08g29170.1 downstream_gene_variant ; 1673.0bp to feature; MODIFIER silent_mutation Average:57.451; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N
vg0817853841 A -> G LOC_Os08g29160.1 intron_variant ; MODIFIER silent_mutation Average:57.451; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817853841 NA 2.62E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0817853841 NA 1.72E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 8.34E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 1.64E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 1.87E-07 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 1.05E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 4.17E-06 1.81E-07 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 4.08E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 8.73E-06 8.72E-06 mr1674_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 9.91E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 2.36E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 1.68E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 2.48E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 7.31E-07 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 1.55E-06 1.55E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 1.85E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 2.37E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817853841 NA 4.23E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251