\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817816804:

Variant ID: vg0817816804 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17816804
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAACATGATGACATTGTTGTGTACATAAAGAACAATCGCATCATTTCGTTTCGCCTATGTGCAACGGCTAAAACAATAGTCATCAGCAAGCATGAACAA[T/A]
TATCCTGATTCCTCAATTAGAACACTCATTAAGTTTTCCTTGTTACTACATAGACCATGCACATTCCATACACACTATCCTGATTCCTGTGAATTATAAT

Reverse complement sequence

ATTATAATTCACAGGAATCAGGATAGTGTGTATGGAATGTGCATGGTCTATGTAGTAACAAGGAAAACTTAATGAGTGTTCTAATTGAGGAATCAGGATA[A/T]
TTGTTCATGCTTGCTGATGACTATTGTTTTAGCCGTTGCACATAGGCGAAACGAAATGATGCGATTGTTCTTTATGTACACAACAATGTCATCATGTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.10% 0.11% 0.30% NA
All Indica  2759 90.40% 9.30% 0.14% 0.22% NA
All Japonica  1512 46.00% 53.80% 0.00% 0.13% NA
Aus  269 13.80% 85.50% 0.00% 0.74% NA
Indica I  595 97.30% 2.50% 0.00% 0.17% NA
Indica II  465 91.00% 9.00% 0.00% 0.00% NA
Indica III  913 86.20% 13.40% 0.33% 0.11% NA
Indica Intermediate  786 89.60% 9.80% 0.13% 0.51% NA
Temperate Japonica  767 18.00% 82.00% 0.00% 0.00% NA
Tropical Japonica  504 79.00% 20.80% 0.00% 0.20% NA
Japonica Intermediate  241 66.40% 33.20% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 2.10% 1.04% 2.08% NA
Intermediate  90 67.80% 30.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817816804 T -> A LOC_Os08g29090.1 downstream_gene_variant ; 3466.0bp to feature; MODIFIER silent_mutation Average:65.908; most accessible tissue: Callus, score: 85.135 N N N N
vg0817816804 T -> A LOC_Os08g29110.1 downstream_gene_variant ; 1630.0bp to feature; MODIFIER silent_mutation Average:65.908; most accessible tissue: Callus, score: 85.135 N N N N
vg0817816804 T -> A LOC_Os08g29110.2 downstream_gene_variant ; 1619.0bp to feature; MODIFIER silent_mutation Average:65.908; most accessible tissue: Callus, score: 85.135 N N N N
vg0817816804 T -> A LOC_Os08g29100.1 intron_variant ; MODIFIER silent_mutation Average:65.908; most accessible tissue: Callus, score: 85.135 N N N N
vg0817816804 T -> DEL N N silent_mutation Average:65.908; most accessible tissue: Callus, score: 85.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817816804 NA 4.99E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 5.71E-07 5.71E-07 mr1040 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 9.53E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 2.05E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 8.98E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 4.82E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 6.18E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 6.19E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 3.60E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 7.14E-06 8.36E-13 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 3.81E-08 3.81E-08 mr1836 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 1.38E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 3.61E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817816804 NA 9.48E-06 mr1362_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251