Search for Variation information by Variation ID:
Detailed information for vg0817806141:
| Variant ID: vg0817806141 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 17806141 |
| Reference Allele: CAG | Alternative Allele: TAG,C |
| Primary Allele: CAG | Secondary Allele: TAG |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GGAAGAAAACCGCAAAGAATATAATCCTCAACCGCAACCATGAGGCCTAGGACAGGTTCGGGTTCAATACCTCCTGGTTCTCTCTCCATGGTCCCGCGAC[CAG/TAG,C]
GGAGAGCACCGTCCTCCTGCAGCTTCTTCAGGGACGCGCTGGTGGAAGTGGACTTGTCGAGATCCATTGCCGCCGGAGATCGTCGGAGAAGGGACCGAGA
Reverse complement sequence
TCTCGGTCCCTTCTCCGACGATCTCCGGCGGCAATGGATCTCGACAAGTCCACTTCCACCAGCGCGTCCCTGAAGAAGCTGCAGGAGGACGGTGCTCTCC[CTG/CTA,G]
GTCGCGGGACCATGGAGAGAGAACCAGGAGGTATTGAACCCGAACCTGTCCTAGGCCTCATGGTTGCGGTTGAGGATTATATTCTTTGCGGTTTTCTTCC
Allele Frequencies:
| Populations | Population Size | Frequency of CAG(primary allele) | Frequency of TAG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.20% | 9.50% | 10.58% | 9.56% | C: 0.17% |
| All Indica | 2759 | 53.20% | 16.00% | 16.56% | 13.95% | C: 0.29% |
| All Japonica | 1512 | 94.00% | 0.30% | 2.25% | 3.51% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 43.20% | 25.40% | 25.88% | 5.55% | NA |
| Indica II | 465 | 46.90% | 20.60% | 18.92% | 13.55% | NA |
| Indica III | 913 | 64.80% | 4.40% | 13.03% | 17.42% | C: 0.33% |
| Indica Intermediate | 786 | 51.00% | 19.60% | 12.21% | 16.54% | C: 0.64% |
| Temperate Japonica | 767 | 97.50% | 0.30% | 1.69% | 0.52% | NA |
| Tropical Japonica | 504 | 88.30% | 0.20% | 3.37% | 8.13% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.40% | 1.66% | 3.32% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 4.40% | 10.00% | 14.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817806141 | CAG -> C | LOC_Os08g29080.1 | frameshift_variant ; p.Pro23fs; HIGH | frameshift_variant | Average:13.645; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0817806141 | CAG -> TAG | LOC_Os08g29080.1 | missense_variant ; p.Gly24Ser; MODERATE | nonsynonymous_codon ; G24S | Average:13.645; most accessible tissue: Zhenshan97 panicle, score: 28.447 | possibly damaging  |
+1.834 |
N | N |
| vg0817806141 | CAG -> DEL | LOC_Os08g29080.1 | N | frameshift_variant | Average:13.645; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817806141 | NA | 1.92E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | 6.93E-06 | NA | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | 1.12E-06 | 6.93E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | 2.13E-08 | 2.13E-08 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | NA | 6.25E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | 7.60E-06 | NA | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | NA | 9.33E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817806141 | 3.62E-07 | 8.89E-08 | mr1226_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |