\
| Variant ID: vg0817796326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17796326 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAGTTCTACTTGGAGACCAATTGACCCGCGGTATAAAAGGGACCCCCGGGAGGACCTAAGGCATCGAATCTCACCGCCAACACAACCACCACAGCCTACG[A/G]
AGTCGGAACCTTCAGGAGCCAAGTCACCGGAGTGATCTAGTCGAGCCAACTCGACTACGGTCTCGTCGTTATCATCGAGTTCTGCTATTCCCTTTGTAAT
ATTACAAAGGGAATAGCAGAACTCGATGATAACGACGAGACCGTAGTCGAGTTGGCTCGACTAGATCACTCCGGTGACTTGGCTCCTGAAGGTTCCGACT[T/C]
CGTAGGCTGTGGTGGTTGTGTTGGCGGTGAGATTCGATGCCTTAGGTCCTCCCGGGGGTCCCTTTTATACCGCGGGTCAATTGGTCTCCAAGTAGAACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 2.10% | 2.88% | 7.70% | NA |
| All Indica | 2759 | 95.90% | 1.80% | 0.80% | 1.56% | NA |
| All Japonica | 1512 | 72.50% | 2.60% | 5.89% | 19.05% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 97.50% | 1.20% | 0.67% | 0.67% | NA |
| Indica II | 465 | 97.40% | 1.10% | 0.65% | 0.86% | NA |
| Indica III | 913 | 94.30% | 2.20% | 1.10% | 2.41% | NA |
| Indica Intermediate | 786 | 95.50% | 2.20% | 0.64% | 1.65% | NA |
| Temperate Japonica | 767 | 85.10% | 0.30% | 1.56% | 13.04% | NA |
| Tropical Japonica | 504 | 63.10% | 6.70% | 12.50% | 17.66% | NA |
| Japonica Intermediate | 241 | 51.90% | 1.20% | 5.81% | 41.08% | NA |
| VI/Aromatic | 96 | 42.70% | 9.40% | 22.92% | 25.00% | NA |
| Intermediate | 90 | 85.60% | 3.30% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817796326 | A -> G | LOC_Os08g29060.1 | upstream_gene_variant ; 321.0bp to feature; MODIFIER | silent_mutation | Average:9.136; most accessible tissue: Callus, score: 28.795 | N | N | N | N |
| vg0817796326 | A -> G | LOC_Os08g29070.1 | upstream_gene_variant ; 2458.0bp to feature; MODIFIER | silent_mutation | Average:9.136; most accessible tissue: Callus, score: 28.795 | N | N | N | N |
| vg0817796326 | A -> G | LOC_Os08g29050.1 | downstream_gene_variant ; 2072.0bp to feature; MODIFIER | silent_mutation | Average:9.136; most accessible tissue: Callus, score: 28.795 | N | N | N | N |
| vg0817796326 | A -> G | LOC_Os08g29050-LOC_Os08g29060 | intergenic_region ; MODIFIER | silent_mutation | Average:9.136; most accessible tissue: Callus, score: 28.795 | N | N | N | N |
| vg0817796326 | A -> DEL | N | N | silent_mutation | Average:9.136; most accessible tissue: Callus, score: 28.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817796326 | 3.09E-06 | NA | mr1457_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817796326 | 6.19E-06 | NA | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817796326 | 2.45E-06 | 2.45E-06 | mr1704_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817796326 | NA | 9.12E-06 | mr1827_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |