\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817796326:

Variant ID: vg0817796326 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17796326
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTTCTACTTGGAGACCAATTGACCCGCGGTATAAAAGGGACCCCCGGGAGGACCTAAGGCATCGAATCTCACCGCCAACACAACCACCACAGCCTACG[A/G]
AGTCGGAACCTTCAGGAGCCAAGTCACCGGAGTGATCTAGTCGAGCCAACTCGACTACGGTCTCGTCGTTATCATCGAGTTCTGCTATTCCCTTTGTAAT

Reverse complement sequence

ATTACAAAGGGAATAGCAGAACTCGATGATAACGACGAGACCGTAGTCGAGTTGGCTCGACTAGATCACTCCGGTGACTTGGCTCCTGAAGGTTCCGACT[T/C]
CGTAGGCTGTGGTGGTTGTGTTGGCGGTGAGATTCGATGCCTTAGGTCCTCCCGGGGGTCCCTTTTATACCGCGGGTCAATTGGTCTCCAAGTAGAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 2.10% 2.88% 7.70% NA
All Indica  2759 95.90% 1.80% 0.80% 1.56% NA
All Japonica  1512 72.50% 2.60% 5.89% 19.05% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 97.50% 1.20% 0.67% 0.67% NA
Indica II  465 97.40% 1.10% 0.65% 0.86% NA
Indica III  913 94.30% 2.20% 1.10% 2.41% NA
Indica Intermediate  786 95.50% 2.20% 0.64% 1.65% NA
Temperate Japonica  767 85.10% 0.30% 1.56% 13.04% NA
Tropical Japonica  504 63.10% 6.70% 12.50% 17.66% NA
Japonica Intermediate  241 51.90% 1.20% 5.81% 41.08% NA
VI/Aromatic  96 42.70% 9.40% 22.92% 25.00% NA
Intermediate  90 85.60% 3.30% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817796326 A -> G LOC_Os08g29060.1 upstream_gene_variant ; 321.0bp to feature; MODIFIER silent_mutation Average:9.136; most accessible tissue: Callus, score: 28.795 N N N N
vg0817796326 A -> G LOC_Os08g29070.1 upstream_gene_variant ; 2458.0bp to feature; MODIFIER silent_mutation Average:9.136; most accessible tissue: Callus, score: 28.795 N N N N
vg0817796326 A -> G LOC_Os08g29050.1 downstream_gene_variant ; 2072.0bp to feature; MODIFIER silent_mutation Average:9.136; most accessible tissue: Callus, score: 28.795 N N N N
vg0817796326 A -> G LOC_Os08g29050-LOC_Os08g29060 intergenic_region ; MODIFIER silent_mutation Average:9.136; most accessible tissue: Callus, score: 28.795 N N N N
vg0817796326 A -> DEL N N silent_mutation Average:9.136; most accessible tissue: Callus, score: 28.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817796326 3.09E-06 NA mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817796326 6.19E-06 NA mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817796326 2.45E-06 2.45E-06 mr1704_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817796326 NA 9.12E-06 mr1827_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251