Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817748273:

Variant ID: vg0817748273 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17748273
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTAGCTGTTGGAATTAATAGATGGGCTAAGGCCCATTCGAAGATTAATTCTTTGGAAAATCATAAAAACCCACCTCATGGGATGGCATGCATGTGGAG[C/T]
TTAGCACCACCTTGCTTATTCTAGGAGAGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGAAGCATGTGTGGTGGAGAGAAGAGGGGGAAC

Reverse complement sequence

GTTCCCCCTCTTCTCTCCACCACACATGCTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTAAGGAGGTCCCCTCTCCTAGAATAAGCAAGGTGGTGCTAA[G/A]
CTCCACATGCATGCCATCCCATGAGGTGGGTTTTTATGATTTTCCAAAGAATTAATCTTCGAATGGGCCTTAGCCCATCTATTAATTCCAACAGCTAGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.50%	1.20%	6.35%	72.89%	NA
All Indica	2759	2.90%	1.40%	2.79%	92.90%	NA
All Japonica	1512	54.40%	0.00%	0.33%	45.24%	NA
Aus	269	0.70%	5.90%	76.21%	17.10%	NA
Indica I	595	4.50%	0.00%	1.01%	94.45%	NA
Indica II	465	4.30%	4.70%	1.08%	89.89%	NA
Indica III	913	1.00%	0.50%	2.74%	95.73%	NA
Indica Intermediate	786	3.10%	1.50%	5.22%	90.20%	NA
Temperate Japonica	767	82.40%	0.00%	0.26%	17.34%	NA
Tropical Japonica	504	21.60%	0.00%	0.40%	77.98%	NA
Japonica Intermediate	241	34.00%	0.00%	0.41%	65.56%	NA
VI/Aromatic	96	1.00%	0.00%	4.17%	94.79%	NA
Intermediate	90	18.90%	3.30%	10.00%	67.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817748273	C -> T	LOC_Os08g28990.1	upstream_gene_variant ; 4222.0bp to feature; MODIFIER	silent_mutation	Average:11.09; most accessible tissue: Callus, score: 30.233	N	N	N	N
vg0817748273	C -> T	LOC_Os08g29000.1	upstream_gene_variant ; 881.0bp to feature; MODIFIER	silent_mutation	Average:11.09; most accessible tissue: Callus, score: 30.233	N	N	N	N
vg0817748273	C -> T	LOC_Os08g28990-LOC_Os08g29000	intergenic_region ; MODIFIER	silent_mutation	Average:11.09; most accessible tissue: Callus, score: 30.233	N	N	N	N
vg0817748273	C -> DEL	N	N	silent_mutation	Average:11.09; most accessible tissue: Callus, score: 30.233	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817748273	8.20E-07	7.10E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	3.77E-09	3.77E-09	mr1040	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	NA	7.87E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	NA	2.72E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	7.23E-07	2.12E-10	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	9.78E-08	9.78E-08	mr1836	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	NA	3.34E-06	mr1040_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	3.15E-06	NA	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	2.93E-07	1.71E-08	mr1362_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	5.32E-06	NA	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748273	NA	2.20E-07	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251