\
| Variant ID: vg0817688257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17688257 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 100. )
CACTCAAAGTATTTAAGAGAAGTTTTATCTAGCTCAACACTTACTTTAATTATTAAAAAAATACCTAGAAATTTCTTTTTCACAACAATTTATAATTTAG[C/T]
GGTTTTTAGGGTCTGACAGTTATCCGCATCGTAACCTCTCACTGACAAGCAAGACAAAAACAATGTGAATATATATTTGTGAACAATATGGTAACTGATG
CATCAGTTACCATATTGTTCACAAATATATATTCACATTGTTTTTGTCTTGCTTGTCAGTGAGAGGTTACGATGCGGATAACTGTCAGACCCTAAAAACC[G/A]
CTAAATTATAAATTGTTGTGAAAAAGAAATTTCTAGGTATTTTTTTAATAATTAAAGTAAGTGTTGAGCTAGATAAAACTTCTCTTAAATACTTTGAGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 15.70% | 0.06% | 0.87% | NA |
| All Indica | 2759 | 88.40% | 10.00% | 0.04% | 1.49% | NA |
| All Japonica | 1512 | 71.80% | 28.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.20% | 32.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.30% | 1.50% | 0.00% | 4.16% | NA |
| Indica Intermediate | 786 | 92.20% | 7.30% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 30.60% | 69.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817688257 | C -> T | LOC_Os08g28920.1 | upstream_gene_variant ; 2970.0bp to feature; MODIFIER | silent_mutation | Average:62.507; most accessible tissue: Callus, score: 95.005 | N | N | N | N |
| vg0817688257 | C -> T | LOC_Os08g28930.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.507; most accessible tissue: Callus, score: 95.005 | N | N | N | N |
| vg0817688257 | C -> DEL | N | N | silent_mutation | Average:62.507; most accessible tissue: Callus, score: 95.005 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817688257 | NA | 1.96E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 6.34E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 2.43E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 9.70E-06 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 8.39E-09 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 1.11E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 8.06E-07 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | 7.87E-06 | 2.54E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 8.06E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | 8.48E-06 | 8.47E-06 | mr1674_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 5.83E-06 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 1.07E-06 | mr1832_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 1.23E-06 | mr1833_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 7.42E-07 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | 8.43E-07 | 8.42E-07 | mr1847_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 8.69E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817688257 | NA | 3.32E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |