Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0817661668:

Variant ID: vg0817661668 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17661668
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCTGCTGCTTCTCTACTCTGTGGGCTGGCTACTGGGCTACGTTTGCTTTTTGTTGGGCCGGCCTGCTGCCGTCTTGGCTGGGCTGCTCGCTAGGTTTT[T/C]
CTTTTTTTCGTTTCTCTTTTTGTGCGGAGCGTCAGAGATCGCCGTAATGCATCCGGATTCACGGATTAGCGGCGAAATAATCACGTGGGCCCATCCTTTA

Reverse complement sequence

TAAAGGATGGGCCCACGTGATTATTTCGCCGCTAATCCGTGAATCCGGATGCATTACGGCGATCTCTGACGCTCCGCACAAAAAGAGAAACGAAAAAAAG[A/G]
AAAACCTAGCGAGCAGCCCAGCCAAGACGGCAGCAGGCCGGCCCAACAAAAAGCAAACGTAGCCCAGTAGCCAGCCCACAGAGTAGAGAAGCAGCAGCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 9.50% 2.98% 1.52% NA
All Indica  2759 96.30% 1.50% 1.27% 0.87% NA
All Japonica  1512 72.20% 25.40% 2.38% 0.07% NA
Aus  269 56.50% 3.00% 23.42% 17.10% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.40% 0.43% 0.43% NA
Indica III  913 95.30% 1.90% 1.97% 0.88% NA
Indica Intermediate  786 93.40% 2.90% 1.91% 1.78% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 31.30% 62.50% 5.95% 0.20% NA
Japonica Intermediate  241 74.70% 22.80% 2.49% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 81.10% 11.10% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817661668 T -> C LOC_Os08g28880.1 upstream_gene_variant ; 1912.0bp to feature; MODIFIER silent_mutation Average:94.162; most accessible tissue: Minghui63 root, score: 97.073 N N N N
vg0817661668 T -> C LOC_Os08g28870-LOC_Os08g28880 intergenic_region ; MODIFIER silent_mutation Average:94.162; most accessible tissue: Minghui63 root, score: 97.073 N N N N
vg0817661668 T -> DEL N N silent_mutation Average:94.162; most accessible tissue: Minghui63 root, score: 97.073 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817661668 T C 0.0 -0.02 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817661668 1.12E-11 3.01E-27 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 2.02E-17 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 4.88E-13 4.51E-22 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 3.91E-06 4.44E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 5.15E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 7.99E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 1.97E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 1.78E-07 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 7.65E-14 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 1.35E-09 8.90E-25 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 3.43E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 1.43E-12 2.98E-21 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 4.90E-07 2.53E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 5.74E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 1.71E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 1.55E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 3.44E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 1.25E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 1.10E-12 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 3.32E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817661668 NA 1.26E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251