\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817615040:

Variant ID: vg0817615040 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17615040
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTAGGCATTCAATCTTGTCATTGCATGCAGTAGTTTGAAAGGCCTAAAGTTGTTGAGTAAGGTAAAACAAAAGATTACTACTCCGTCCTAAAAAAAAT[C/T]
TAATCCTAGTAATAAATCTGGATATGTATATTGGTTTTTTTTTCCAATCCTAACAGGAAACTTGGACACGTATATTTTTTTTTAGACGGAGGGTACGTGC

Reverse complement sequence

GCACGTACCCTCCGTCTAAAAAAAAATATACGTGTCCAAGTTTCCTGTTAGGATTGGAAAAAAAAACCAATATACATATCCAGATTTATTACTAGGATTA[G/A]
ATTTTTTTTAGGACGGAGTAGTAATCTTTTGTTTTACCTTACTCAACAACTTTAGGCCTTTCAAACTACTGCATGCAATGACAAGATTGAATGCCTACTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.50% 0.04% 0.17% NA
All Indica  2759 90.10% 9.60% 0.04% 0.29% NA
All Japonica  1512 17.40% 82.50% 0.07% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 92.40% 7.40% 0.00% 0.17% NA
Indica II  465 93.50% 6.20% 0.22% 0.00% NA
Indica III  913 88.20% 11.40% 0.00% 0.44% NA
Indica Intermediate  786 88.40% 11.20% 0.00% 0.38% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 40.30% 59.70% 0.00% 0.00% NA
Japonica Intermediate  241 18.30% 81.30% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817615040 C -> T LOC_Os08g28800.1 upstream_gene_variant ; 2852.0bp to feature; MODIFIER silent_mutation Average:64.96; most accessible tissue: Callus, score: 82.988 N N N N
vg0817615040 C -> T LOC_Os08g28790.1 downstream_gene_variant ; 667.0bp to feature; MODIFIER silent_mutation Average:64.96; most accessible tissue: Callus, score: 82.988 N N N N
vg0817615040 C -> T LOC_Os08g28790-LOC_Os08g28800 intergenic_region ; MODIFIER silent_mutation Average:64.96; most accessible tissue: Callus, score: 82.988 N N N N
vg0817615040 C -> DEL N N silent_mutation Average:64.96; most accessible tissue: Callus, score: 82.988 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817615040 1.07E-07 7.45E-14 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 2.70E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 1.42E-16 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 1.13E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 2.42E-08 1.04E-13 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 1.49E-06 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 8.68E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 2.02E-10 1.27E-21 mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 1.98E-09 4.61E-25 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 1.73E-06 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 4.10E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 1.74E-10 2.27E-23 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 6.12E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040 NA 2.26E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251