Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817615040:

Variant ID: vg0817615040 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17615040
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTAGGCATTCAATCTTGTCATTGCATGCAGTAGTTTGAAAGGCCTAAAGTTGTTGAGTAAGGTAAAACAAAAGATTACTACTCCGTCCTAAAAAAAAT[C/T]
TAATCCTAGTAATAAATCTGGATATGTATATTGGTTTTTTTTTCCAATCCTAACAGGAAACTTGGACACGTATATTTTTTTTTAGACGGAGGGTACGTGC

Reverse complement sequence

GCACGTACCCTCCGTCTAAAAAAAAATATACGTGTCCAAGTTTCCTGTTAGGATTGGAAAAAAAAACCAATATACATATCCAGATTTATTACTAGGATTA[G/A]
ATTTTTTTTAGGACGGAGTAGTAATCTTTTGTTTTACCTTACTCAACAACTTTAGGCCTTTCAAACTACTGCATGCAATGACAAGATTGAATGCCTACTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	39.50%	0.04%	0.17%	NA
All Indica	2759	90.10%	9.60%	0.04%	0.29%	NA
All Japonica	1512	17.40%	82.50%	0.07%	0.00%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	92.40%	7.40%	0.00%	0.17%	NA
Indica II	465	93.50%	6.20%	0.22%	0.00%	NA
Indica III	913	88.20%	11.40%	0.00%	0.44%	NA
Indica Intermediate	786	88.40%	11.20%	0.00%	0.38%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	40.30%	59.70%	0.00%	0.00%	NA
Japonica Intermediate	241	18.30%	81.30%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817615040	C -> T	LOC_Os08g28800.1	upstream_gene_variant ; 2852.0bp to feature; MODIFIER	silent_mutation	Average:64.96; most accessible tissue: Callus, score: 82.988	N	N	N	N
vg0817615040	C -> T	LOC_Os08g28790.1	downstream_gene_variant ; 667.0bp to feature; MODIFIER	silent_mutation	Average:64.96; most accessible tissue: Callus, score: 82.988	N	N	N	N
vg0817615040	C -> T	LOC_Os08g28790-LOC_Os08g28800	intergenic_region ; MODIFIER	silent_mutation	Average:64.96; most accessible tissue: Callus, score: 82.988	N	N	N	N
vg0817615040	C -> DEL	N	N	silent_mutation	Average:64.96; most accessible tissue: Callus, score: 82.988	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817615040	1.07E-07	7.45E-14	mr1040	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	2.70E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	1.42E-16	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	1.13E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	2.42E-08	1.04E-13	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	1.49E-06	mr1836	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	8.68E-11	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	2.02E-10	1.27E-21	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	1.98E-09	4.61E-25	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	1.73E-06	mr1362_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	4.10E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	1.74E-10	2.27E-23	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	6.12E-06	mr1836_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817615040	NA	2.26E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251