\
| Variant ID: vg0817612440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17612440 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGAAAGGAAGAGAGGATGGGATAAAAAAATCTGTAAAGGTGAGTGTTATTTTTGTATGCAGTCCACTTAAGAGGCTCGCCTGCGAAATATGCTTATTTTT[G/A]
CGTGTGGTCCATATAAGAGGCCCGTAAGTGAAAATCTATTTTTCAATGCGATCCTCTTAAGGAGCCGCACACGAAAATGGAGGACAATTTTTGCAGACGC
GCGTCTGCAAAAATTGTCCTCCATTTTCGTGTGCGGCTCCTTAAGAGGATCGCATTGAAAAATAGATTTTCACTTACGGGCCTCTTATATGGACCACACG[C/T]
AAAAATAAGCATATTTCGCAGGCGAGCCTCTTAAGTGGACTGCATACAAAAATAACACTCACCTTTACAGATTTTTTTATCCCATCCTCTCTTCCTTTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 40.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 17.40% | 82.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 27.90% | 72.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 10.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.30% | 97.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.70% | 60.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817612440 | G -> A | LOC_Os08g28790.1 | upstream_gene_variant ; 1131.0bp to feature; MODIFIER | silent_mutation | Average:68.681; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg0817612440 | G -> A | LOC_Os08g28784-LOC_Os08g28790 | intergenic_region ; MODIFIER | silent_mutation | Average:68.681; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817612440 | 8.80E-07 | 9.72E-14 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 2.70E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | 3.19E-06 | 2.35E-18 | mr1362 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 1.13E-08 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 1.94E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | 1.15E-10 | 3.00E-16 | mr1836 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 1.49E-06 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 8.68E-11 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | 8.66E-10 | 1.41E-22 | mr1040_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | 2.89E-10 | 1.93E-27 | mr1362_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 1.73E-06 | mr1362_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 4.10E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | 4.12E-11 | 1.77E-25 | mr1836_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 6.12E-06 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817612440 | NA | 1.07E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |